Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name OPT2
Systematic Name YPR194C
Description Oligopeptide transporter; member of the OPT family, with potential orthologs in S. pombe and C. albicans; also plays a role in formation of mature vacuoles
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OPT2	6325452 upstream sequence, from -1000 to -1, size 1000
CGCGTTTTTCCTATTTGGGTACGGAGATATTTATGTTTTGATAAGCAAATGCTTCAATTG
TGCCGTGCGCATCATCAATCCCACTCACTGAGGAACTCTATAATGAAAAAAAAACAAACA
GGCAAAAGCAGATAGACCAATAATTGATATCTGATTTTTCACAAAAAATGCAGGAGAGAT
CAGCATTAAACGGATCCATCACATCCACCGGACGAATCCGTCTCAAATATGGCAGCCACG
CTGGTGTGACACATAATATTACTGCAACACTTCTTATCTCATTATTTTTATCATGGTAAA
AGAAGTCAACACTATGCGAGGAATACCAAAAGAAAATTTGGTTCACATCATGGTGTCAGT
AAAAGCAACCGACAAAAATCGGGGGGTTGCTGTCCGACGTAGTTTCTTCGTTATAATTTT
CAATAATCCCACATTTCGTTGTTAACCTTTTGCAAAAATTGATGTAGTTTGTTTTCCTCT
TGGCCCCTGTTGTGGTTACCGAACACGTGAATCGCCATTGCGGTTGTCAATATCAGCCCA
TTGGGTTTTATGAAGATTCGTAACACCTTCGATTATTTAAGTTTATTCTCTTATCTACAA
TAATAATAGCGTTCTTTTACAATTGGACGCTGTTATCTTACTTCTGAATGTTCATGGATT
GGAAATTTTCAATCATTTCACGAATTATTAGCAATGAAGATAAGTAACATTAAAAAAAAT
ATTGATATCAACTTGCTAGGTTTCTTCTCGCTTCAAAAAAATTTATAAATGGGAATGGAA
CACTATCCTGTGTAAACTTAAGTCATGTCTCAAGTCAGTTGTTACTTATATTCATTCCTA
TCGAAACATCCCAAAAAATAATATTTGAAACACTTACAATCATACATTGAACGTCTAAAC
AACGGCGGCATTTTTTTAATAGCAGAAACGAACATATTAGCTTATTCTACAACTAGTAGG
GTTTGTTATACGCAATATTGCTGTTGAATTATTAGAAATT
Chromosomal Coordinates Chr XVI from 926937-924304
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator