Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALD4
Systematic Name YOR374W
Alias ALD7, ALDH2
Description Mitochondrial aldehyde dehydrogenase, required for growth on ethanol and conversion of acetaldehyde to acetate; phosphorylated; activity is K+ dependent; utilizes NADP+ or NAD+ equally as coenzymes; expression is glucose repressed
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ALD4	6324950 upstream sequence, from -1000 to -1, size 1000
AGCGCTTTCCATCAAAAATACAGGAGGCGCGCTATCCAAATTACAAAATTACAAGTTGGA
TGATCAATTCACGTTCCCCTACCAAAATCTAAAGATTCTAAAACTGGACGGCTTCGCTCA
ACTTAGCAAATGGCAAAAATGGCCTGCCACTTTGCAAATTCTGGAGATCAACGGCGGCCT
GGCCTCCTCTTTGCCGCGATTCTCTTCTCTAAAATCCACCAACTTATATTCTCTAACTAT
AGCTAATGTTAGAGACTTCACACACTTACCAGTGGACCTCTCCAAGGAACTACCGTTCTT
GCAAGAGCTACATCTGCCAGGCAACAACCTACAAAACGCACACAAGTTAACAAAAACTCT
CCCACGCCAATCAGTAAAATTTCTTGATCTACGAAATAACCCAATCACGACACCACGCCA
CGATCGCGCCAGCACGAGCTTGCATTACCGGCAGTTGCTCCAGCTTGCTGGCCTCTGCCA
GCAGCAATGTCCCGCCCTGGCGACCCTCTGGTTAGATGACACTCCTGCCCCAACTGCCAC
GAATCTGTAACCCCATAACTATACCCGTACGCAGTACTAAAAATGTATGTAATTAGTAAA
TGTATGTAACAATTTCACCGTTTTGTGTAACAATTCATTCATTCATTCTTTTGATCCTTT
AGTACCGTCCGCACATGATGTCATTTCCCCCTCATTTTTGTTTGCTGGTATGATTCCCCG
CCCGGGCGACGGTACGGCTGTTATCCAGCGATGCGGGACTTCCGTCCACAGGTATCTTTT
TCTCCAACTCCAACAGAGATGGAAAATGAGGGGCGGGTGTAGGTAAGCAGAATGAGGAGA
AATTTGTAATGAAAATGGAAGTTCGGCGGTTATATAAATGGGGGGGGTTTGTCGGTGACA
ATTGACTTCACTCTCCTTTCCTCAAAAATTCTTGGGTGTTAGGATTAGAAGTATCTGGAA
AACCAACCAAGAAAACTACAATAACAAAAATAAATAAAGC
Chromosomal Coordinates Chr XV from 1039840-1041399
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator