Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPB8
Systematic Name YOR224C
Description RNA polymerase subunit ABC14.5, common to RNA polymerases I, II, and III
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPB8	6324798 upstream sequence, from -1000 to -1, size 1000
CAGGCCCAACGTTTTTTGGCGCCCTCGTTTTTTCCCTATGCGGAACCTACTATTAATAAG
CACCTGGGGCCGGCCGGTGCAGCAGTATAGCAGTATATAACAACAGCAAAAGAAGCATAT
GTAGACAACGCTGAGGTTTCATTACAGCTCATACATCACCAACAAACATAGCACAGCATA
GATGTTCGCCAGACTCGCTAATCCTGCCCACTTCAAGCCTCTCACGGGCTCCCACATAAC
AAGAGCTGCCAAAAGACTTTACCATCCTAAGGTAATTGACCACTACACAAACCCAAGAAA
CGTTGGGTCCATGGATAAGTCCTTAGCTAATGTCGGCACAGGAATCGTGGGCGCCCCTGC
GTGTGGTGATGTGATAAAACTACAAATACAGGTGAATGATAAATCGGGTATTATCGAGAA
CGTTAAGTTCAAGACCTTCGGGTGTGGGTCTGCCATCGCTTCCTCCTCCTACATGACCGA
GCTGGTACGCGGTATGTCACTTGATGAGGCCGTTAAAATTAAAAACACGGAAATCGCGAA
GGAGCTAAGTCTTCCTCCAGTAAAACTGCATTGTTCCATGCTTGCAGAAGACGCTATCAA
GGCGGCAATCAAGGACTACAAAACAAAGAGGAACCCCTCCGTTTTGCATTGAAAGAGAGG
CGATACGATAATATGATAAAATACAAGAGGTCCTCTCTTTCCGGTTTTTTTTTTCTGGTT
GTTTTATAGAAAGGGTTAAAAGAATAATTAGGTATAATAATAAGTAATTAATATCAGAAA
CAGTCATAATACTAGTGACATTATGTATCAAATTTTGACTTAGTTTTTTCATGTTCGTCA
GACGTGATAGGTTTTCTCCAGGTCTTATTTTCATCTTTCATTTTCACATTTTTTTTTTTC
TAAAGCGAAAACTAAGATGAAAAATTTCAGAATATTTAAACTGTGATGGCAGCTATAAAA
GCCCAGTTGCCAGCTCATTGCTTCCATAACAACCGCAGCA
Chromosomal Coordinates Chr XV from 761265-760825
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator