Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PEX11
Systematic Name YOL147C
Alias PMP24, PMP27
Description Peroxisomal membrane protein required for medium-chain fatty acid oxidation and peroxisome proliferation, possibly by inducing membrane curvature; localization regulated by phosphorylation; transcription regulated by Adr1p and Pip2p-Oaf1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX11	6324425 upstream sequence, from -1000 to -1, size 1000
AAGAAGCTCAAATGAGCGGTTCGGAACAAAATAAAAACGATGACAACGACGAAAACAATG
ATAATGATGATAACGACGGATTGTTCTAAGAAGAGGCGAGGGTTAGAATCAAGACTTTTA
AAGAAACTTAATATTATACTGTTGCCTTTTTTTTATAGTTATTTTATATAGTGTATTTCT
AAAGAAAAAGATGTGTTATTTTTTAAACATCCACCTTTTCGTGTCCTTATAAGATTCATG
AGACTTTTTATATATCTCCTTCTCCATTTCTTCTAGTTTCAGTAAAAATGTGCTAGTTGC
TATATTAGTGTTCGCTGAATTTTTTCCGGTCGAGTCTGCATTGAGATCAATCGATAAACT
ACTAGCATGATGATTAAGTTCTTGGGCACGTTGCAAAAGTAGCTCACTAACGACATTGGC
CAGTTCTTTTTCGCTAAACAACATTATCCATTTTATGGCTAGACTGAAGAAATGCGAATT
TATGGAATGCAAGTCCAGAGCCACCGGATCGGTCTTTATAGCGTTCATAACTTTCGTAGA
AAACATATCTGGTGGCAGGAGTTCCACAAAAGGTACAGGTTCTTCATCTACCAAGGCTTC
GTCACCACCCACAATTGCAAGGATTCTTGCTAACCATAGTGGCAGGCTTAGTTTAGTGTT
TTTCGTTATGGGTCGTCCTGGGTTGTTTTCCAAATAACCAAGACCAGGAATATCATATTG
AAATTTACAAGGAAACTCTGTCCCATCTGCTAGGACATCATCAATGTCATAGTAACCCAT
CCTTTCTATGCTTGCCCTTCTATTGTAAAAATATAATACCAAGAACAAAGTTGGCATCAA
TTCCATTGCGATTTTCACTACGCGTCGGCATTTATCTCGGAGAACCCGAAGCGATGGGTA
TATCATTTATAGATATAAAAGGGAAGTGACTCCAACAACTGAAAAACCGTTGTCTCCATC
TACTACTTCAAAGACTTCATCAAGTAATAGTATAATCAAT
Chromosomal Coordinates Chr XV from 48643-47933
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator