Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RRP40
Systematic Name YOL142W
Alias MTR14
Description Exosome non-catalytic core component; involved in 3'-5' RNA processing and degradation in both the nucleus and the cytoplasm; predicted to contain both S1 and KH RNA binding domains; has similarity to human hRrp40p (EXOSC3)
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RRP40	6324430 upstream sequence, from -1000 to -1, size 1000
ATATATACATATATAGTATAGATTTCTCTGCGCTTATTCAAAAAGCATTTTTACCGAACT
TAACAGCCATTTCCACTGCTGCAGCACCCCAATCTTCACCATGGTTGTGCATGGAGTGCG
CTTCATCGATGCCAGCTCTGGCCAGGGCTTGTTCTTCAGTCATGCAAGTTAAGAGGCCAA
AAATGACGGGCATGTCGACTTTTTCTTGTAAGTTCATCAATGCGTGAGTGGTGGAATCTG
AAATGTATTCAAAGTGCATTGTACTACCTTTGATAAGTACACCAATAGGAATTACAACAT
CTAGCGGCTTTCCCAACTTCGCTTGTCTGTCAACAAACCTTTTTGTCCCCCAAGGTAATT
CATAGGATCCAGGAACAGTTTCAATTATTATGTTATTTTCCTCGACACCAAGGGAAGCCA
TTCTTTCAATAGCACCTTTCACAAGAGCGTCAATAATGACACGGTTCCAACGGGCATGAA
TGATACCGACCCTGATTTTGGAACCGTCATAAACTTGATCTGGTTTGCCTAATCCTTTAA
CTGCCATACTGCGTTATACTGCGTTATACTGCGTTATACTGCGTTATACTGTTCCTTTTC
ATGCTTTTGAACCCACTCTCTGGGGCAATATTTCATTGTTCTCTTTTATATGGCTACTTT
TCTCTTATTAACGGGGACCTCCGAAAATATCTCCGCTCCCAGAATATGTCATAGAGCCTT
AAGAATTGACCTACGGGAACCTCCGAAAACCTCCCAGAGTTTTAATTATACGTCATAGAA
CCCCAGACCTCTTCGATGAAGTTTCGTGGAAACTAGTTCCATCCACCTCACTTAAAGTTA
CCTTAATGAAAGCCATCATTGTTTACTAGTAAGGGTAGTGGTGTGACCCGGACCTGATCG
GCTGAAATTTTTTGGTTTAGAGAAGCATATTAAACCAACAGCACAAACGGATGCTTCAGC
AGCTCATCTCCAGCATTTCGACTAACCAAGAGCATACAAG
Chromosomal Coordinates Chr XV from 55558-56280
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator