Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPP2a
Systematic Name YOL039W
Alias RPL44, RPLA2
Description Ribosomal protein P2 alpha, a component of the ribosomal stalk, which is involved in the interaction between translational elongation factors and the ribosome; regulates the accumulation of P1 (Rpp1Ap and Rpp1Bp) in the cytoplasm
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPP2A	6324534 upstream sequence, from -1000 to -1, size 1000
ACGACGGAACCGATCATTTCTGGAACAATGATCATGTTTCTCATGTGGGTTCTGACTGGA
GCTGGCTTTTCATTTTCTGGGGCAGCCAACTTGGCAGCTCTCAACTTCTTCATGAAACCG
GCTGGCTTGGAAGTCATACCACGGGCAAATCTTCTTCTAACTCTAGCTGGGGCCAACTTG
ACGAAATCTTCAGTGGACATTTCCAACAATTTTTCCAAATCGACACCTCTGTAAGAGTGG
GTCTTAAAAACTCTCTTCTTGGCATTAACAGCTTGAGACATGATCGGTCGTGATTATCTT
GTTGTGTACTTCTAGTTCGTCTTATTCTACAATGTAAGGATAAGCACTAACAAATAAGAA
AAAAATGAAATCCAAGAACAAATAAAAGAAGAGACCATACCATAATGTGAAACTCTGCAC
AAAAGATTAAAAAGGAATAAATTGATTGCGGATAGGAAGGGCCAAGCAGACGATTACGGT
GTTGTCTCGCAGCTTCCCAGCAAGGAGTTTCTCAGAGAACCTACTCCGAGTGAAACGGAC
GGAAGAGACCTTCCAAAGAGAAACGAAAATCGGTTCTAGGAGGACGCTCCCTCTAAGTGT
CTAGGCCCGTGTTGGGCGGAACTGCCGCCCAACACGGTTTCCGGGACTATACGCCCAGAC
ATAACATTGATTTATACGCGCGGTGTACGGATTAAAAAAGTTTTGTACCTGTTTTGAGGC
TGTAACTCATGGCAGCCGAGGGGAATACCAGGGGAGAGACTATACCGGACGATATGCGGA
AGACGCGCGAAACGTGAAACATTTTGCATGGAACTCCAAAGCGTTGATACCCGCTTGAAG
TTTAGTTAACCTAGTAGCGGAGAGCCGTTATTATTCGAGGTTTTTCAATTGTTACTTCTG
GTAATTTCTACTTCCGTTTATTCAAAAGCTTTTTCTATTATTTTAGTGATTTTTTTCTCA
TTGGAAATTCATACACAACAACAGAACCAATCATACAAAA
Chromosomal Coordinates Chr XV from 254297-254617
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator