Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GAS5
Systematic Name YOL030W
Description 1,3-beta-glucanosyltransferase, has similarity to Gas1p; localizes to the cell wall
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GAS5	6324543 upstream sequence, from -1000 to -1, size 1000
CTGAAGATACAATTAACTCATGGCTACCATTATCACCGACATTCTTCTCATCATTTAGTT
TTGCCTCTTTTAAACCTGTGTCCATGTTTATTCTAATGTCCAAACCACCGGGGAGTTCTT
GACCTGGCAGTATGGGCTGCCAATCGTGTCTTGGTTCAAATATCTTAGGATAGCAACGAT
TATCAACGCAGATCGAATTCCCTGAAATTTCAAGTTCTTTAAGATCTTCTGCAGATATGA
TTTCGCCTCCAGATGGCACTGAGTGTATGGATGAATGCAATATTGTACTCGCCACTAATT
TCGAAGATAGGGCGCTCAAAATTATGGGAAGAATCCGGACCATTCTAAGTTTGCGTTCTT
GGAAGTGATATTCAATATCGAGAACTTCCAGCGATGCGAAAACTAGTCTATTATAGTTGC
TAATGTGTGCTCTATCATTTACGTGGCCTTTTCACATAGTCTGGTCTTTCTTAATTATCA
CAATTCCGTTACCCGAAATCTAATCTCGTGTTTAGCTTCGATCTGCGGACGTTACTTCTA
ACGTCCAGAACACTTCACCCGCTATTTACGTTTTGATCTAGTTGCGGCCTCCAAACCTGC
AGATGAATCGTTCATTACATTCTTGCTGCCACTAGTTGGCCGCTGCGTATACAACAAGAA
ATATACTATGCATTTATGTAACGCGCTTTAGTCAGTAGCCTCAGTAATGCCTTTTCTAAG
GTCAGTATGTCAATATCTCTCGGGTGAACCCCAACATTGTTGTTCTTTCTTCGTTGTTTC
TCTCTCTTATCATCTTCTGTGTCTTTGCTTTCTTTTGTTCACAATTTCTCGAGAAAAAAA
ACTCCGCAGGAAATTTTTCACTTTTATTTTGCTTATACTATAAATAGGAAGGTCCCTGAA
CTGATTTGTTGACAGTGTTGCATTTCGTATATAAAAGTAAACAGTGGGCTGTAACAAACA
TATTATATATCACTCGCTACACACACAGCTCTAAATAGCT
Chromosomal Coordinates Chr XV from 268187-269641
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator