Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DIS3
Systematic Name YOL021C
Alias MTR17, RRP44
Description Exosome core complex catalytic subunit; possesses both endonuclease and 3'-5' exonuclease activity; involved in 3'-5' RNA processing and degradation in both the nucleus and the cytoplasm; has similarity to E. coli RNase R and to human DIS3
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DIS3	6324552 upstream sequence, from -1000 to -1, size 1000
CCTTGGTTTCAGAGTCCTCTTCAAATTACTTGTGTCGAACGAGCCGTCCAGAGGAGACTT
GAAAGAATCAACACATCGCTGGAAAATATTCCTCTTGCCGTGTTGGTTGTCATCATCGTG
ATGCGATGAGTTTGAATTGTGTGATGAGGATGATGTTAATTGCTTGGATTTGTATTCTAC
AAATCCAAAGTTAGATTTTCGCTCCTTCAGCTCCTCATTTGAACGCTTGACAGAAGAAAT
AAAGTCTTCGGTCATATGAGAGTGTGTTGCGTAATTTGCTTAGCTTATGTTCTTCAGCTA
TTTTTGGGAAATGTCGTGCTCGACGTGTTGAGAAAGTCAGTCACCTCAAAAACTTCACAC
TATTTAGATCCGCAATGCTCAGATGTATATACAAACAAATATGAATATATCCTTTTGAAC
TGGAGTGAATGGTGGGAAATCTCAAATATTTTCTGAAATAGGACCCACACAAGATATTGA
AAGTAAGAGAAAAATTTGTGAAAAACTGCCTACGTACCATTTAACGATACACCCCCACCC
GAACAAGGTTAGACTACTACAGCTAAGTATAGGAGAGGTAGATGCAATATCATGGCAGCA
AAAGAGCGTTCGAATTTTCACTGTCATTTTGTCATTTAATGCCGTTTCTATTCAGTGACA
CATGGCGGAAAAGGAAAAAAAGAAAAGATTTTACCATGCGGCAAAACCGTAAAAAGAAAT
ATTTTTAGCGCCGTAGCTTCTTTAGGGTATTTGTTTAGGTTAGTATTTATTTTTATTAGG
TCATAATAAACCTAAAATAACTTTTAATTAGGGGTTTATTCTTGATTTAAGCCCTATTTC
CGGGTAATTGTTTGCCTTCTTTTCTTTTAGGCATTTTCTCTCATCTCAGAAAAATTTTAA
TGTGTGTGCTACTGCAGTACTTCTTAGAGATACATTGTGAGGGACCCATTGATCAAACGA
GTTTTATTTATCATACTTGCATCATACAGGCCAAAACAAC
Chromosomal Coordinates Chr XV from 285426-282421
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator