Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MPP6
Systematic Name YNR024W
Description Nuclear exosome-associated RNA binding protein; involved in surveillance of pre-rRNAs and pre-mRNAs, and the degradation of cryptic non-coding RNAs (ncRNA); copurifies with ribosomes
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNR024W	6324351 upstream sequence, from -1000 to -1, size 1000
CCATATATAAATACATCCATTTAAATGAATTGCTTACCAATGATGAGTCTGCATTCGAAA
ATTTGATGGGCAACAGGAACAATCACAATAGCAACACCAGTACTAGTAAGATGCTTGATG
CAGCCTCCAGTCAAGTTTCTATTGTAAAATTAGACACTCAGCTTATTACCTTATTACCCA
GCAGTCTTAAAGAATCTTCTCCAGATACAATGAAATTAACGGATTTACTGTCCCTTATTA
ATAGTACTCACCTGCTCCCATTACAGCCAATTGAAATTGATTACACAGTACGCGTTGATA
AAGCTTCCACTTATGGTGAGTTGGTTCTTGATATTGAAGTACCTGATGTCAACGCTCTAA
AATTCAATAATACACAAAGAGAAAGTCAAATTGGGGCTGCTGAATTGAATGAAAATGCCA
GGGAATTGGAACAAATCAAACCCAAGATAGCTTTACAGGACAAAGAAATAACGTCCGTTC
TCTCGAATCTACACGAGAGCAACAAACGATACCGTTTCTTCAAGAAAATTAGTGAGGACC
CAGTTAAAGCATTAAATGAATGCATTGCTTCTACCTCGAATGCTTTGAAAGTTTTATCGG
GAGATGAGGGCTATAATGAAGATATGGTAAGGCGGGCTAACTTTTACAAGGAAAATGAAG
CTATGTTGCGCGAGAATATAGAAGTCATATTATCAAATGGACGAATGTAGGCTTCTTTAC
ATTGATACACAATAGACTGAAGATTTATGTAGTTTTCTTTGTATATAAACTCTAGATAGG
AAAAGAAAGGTCACCATTCATTTATAATAATTAAAGACGAACAGACAATGCTGATTTGTT
TATAGCGCCTACAAGTAATGGCGGCTGTCTGATTCCATTGTCTCTTTCTAAGAAAAGCGC
TGAAAATTTTCTACTGGAAATTTCAGAATATGAAAAAGTAGTAGAGATGAGGGCCACTTA
AACACAATAAGCATATAAGGAACCAAGGGAAAAGCAACAA
Chromosomal Coordinates Chr XIV from 672409-672969
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator