Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SNO2
Systematic Name YNL334C
Description Protein of unknown function, nearly identical to Sno3p; expression is induced before the diauxic shift and also in the absence of thiamin
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNO2	6323995 upstream sequence, from -1000 to -1, size 1000
GCTTTCCCTCTGATAGTGTTGTCTTCAGCAAGTCGACAGGGACGCGTAATTCTGTGGCCT
TAGCTGCAAAATCGGATTCGGTCTTCAAATTCTCTTTATACTGCTGGATCTCCGCCTTAA
TCTTGGTGATGTGCTTGACGGCCTCGGAAACGTCACCGGTACCTGCTTCACCTTTGGTAC
GGATCATTGCAGCACCTTCGTTTATTCTTCTCAAAGCCTCACCTAGATCCTTGGCACCGC
AAACAAATGGCACCTTGAAGTTATGCTTCTCAATGTGATGTGTCCAATCAGCTGGAGTCA
AAACCTCGCTTTCGTCAATGTAGTCTACTTGCAGCTCTTCCAGGATCTGTGCCTCCACGA
AGTGTCCAATACGGACCTTTGCCATCACCGGAATTGAAACAGCTTCCATAATTTCTTTGA
TCATGCGAGGATCTGACATACGGCATACTTGGCCAGACTTGCGCATGTCAGCTGGAATGC
GTTCCAATGCCATTACAGCACAAGCGCCCGCTCTTTCTGCGATAATAGCCTGTTCAGGTG
TGACGACGTCCATAATCACACCGCCCTTTAACATTTGGGCAAGCCCAGTTTTAACCTTGA
ATTCTGACATTTTTGTCTTTTTTACGATATACTTATTTTTCTATTATAGTTCCTTTCCTA
GAAGGGTCGAATAATAATGTGACTATGGTGGAGAAACATACTAGTTTTATATATGTGTGT
GTGTGTGTGTGAAATTCATTCCACATGAACAAATAATTCTGATCTTTCCTTGCCACAACA
TTTTGCCATTCAAACGATATAATGTGCCTACTACTGTTATGCCATTGGGCGGCGCGTCAC
TTTATTGGAAACTGTAAGAATAGTTGAGCCATCTTTCATCATTCAGCTACAAAAAAAAAA
AGTTATTCATTGATAAAAGCCCATTTTTTTCTGTTTGAGTAGCAAGCACACTTACCATGA
CCCCGGTTGCTGGGGCCAAGACAAGAGTAATATCTCAAAA
Chromosomal Coordinates Chr XIV from 12876-12208
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator