Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALF1
Systematic Name YNL148C
Description Alpha-tubulin folding protein, similar to mammalian cofactor B; Alf1p-GFP localizes to cytoplasmic microtubules; required for the folding of alpha-tubulin and may play an additional role in microtubule maintenance
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ALF1	6324181 upstream sequence, from -1000 to -1, size 1000
GAGGGAGGGGTGTATGTGTATGCGGATACTTTTTTGATTTGGCAGAAGGAAAATTGGTAT
TGGCAGCTGTACAGTGACTCCCCTTATACAAATGATCTCAGTTTGTTTCGTTTTTCCTCA
TTCTCTGGCTTTAGACTTCAAATCGCGGTGTAAAAAAAATAGGACAAAACTATGTAGCGC
ATACTATGTCAGTCAGGTATTGAGAATATGTAAAGAAATGCCATACCGTGATTTGATTTT
GTTTTCAACTGTAAGGAAGGGAGTTTATATGAGATTATATTATTAAACCTATTTTTGCAT
ATATAGTACATCAGAACCTTCGGCGGAACTTAAAGAGACCAAAATAGTACCTCTTATGAC
GGTCAAACCTAGCTTTCTTGCGTTTTTAGAAATCAGTTCAGTGTTGTTTTCATCATCAGG
ATTAGACATATATTCTACTGTATCATCAAGTACCAAGTTCATCAGTTGATCATAGCCTTT
TAGGACACCTATAACTAATTTACCACCCATTAATTTGACGCGAATTTTAGAATCTTTATA
CTTCGCTAAATCCAGAATAGCTTCTCTTTTAGGGCCTTCGAATTTTTTCCTTTGCTGTTG
TGGTTTGTTCTCTGATTTCTTAGTTCAAAAAGGAAACATAGTTATTATAATGTTAGTATA
AATAAGTCAAAAGGAAGGTTATTGCCACGGAAGAAAATAAGAAGTGAAACATACGGAGTG
TTGCTGATGCATGTTTTTTTGGTTAATGTTCTGTGTAGTAAACAAAGTGCTGCTCTCAAA
TAACTTTCTTTTTTACTGTAGTAGTATACACGTACATGCGTATTCTTAATTGTCGTTTCC
CAGTTGTCTGTTTTCAGCTACAGCTTTTTTCGCCTTTGTTCGAAAGAACAGTACTTTTTT
CCGGCTCGCAGGGAAACGGCAGTTGAAGAAGACAAGCGACAAGAACATAGAGCAACGAAT
TCAAATAAAGAGATAGAAAAAAAAATTACATGGCAAAACT
Chromosomal Coordinates Chr XIV from 350671-349907
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator