Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALG11
Systematic Name YNL048W
Description Alpha-1,2-mannosyltransferase, catalyzes sequential addition of the two terminal alpha 1,2-mannose residues to the Man5GlcNAc2-PP-dolichol intermediate during asparagine-linked glycosylation in the ER
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ALG11	6324280 upstream sequence, from -1000 to -1, size 1000
GAGAAACATCTAAAAGAAATACATAAACAGATGGTGGGGGTTCCCTAACAGAATATTCTA
CGGGAGCCAAGTAATCCACGACAGAGTTTTTAATTTCGTTTCTTTCATATCTGTTGATTG
GAGCGCCTTGTAAGTTCTGATCAAACCCAAATGGGACATCATTTTTGAAACGGCATATAT
TACATTGCCATTTTCTCCCTTGGTTAATGAAAACGACAAAAGGGTTCATATATGAACGAC
AACGGCGACAGCGGACAATGACTCCGTCAGTATTTAGCGGTACTTGGTTGTCTGAATCTT
GCAAATGCAAATATGGTCTAATAACAATGGCAAATGGTAACTTCGTTTTCTTCAGCAGAG
AGTTTGTTTTTGGCACCGCTTTCAAAGTAGATCTGACGTACTGGTATGGAACATTTGAAT
ATTCGGATGGAGTCACAATGTTATCCTGAGAAATGGTGATTGGAAGAGGTGGTAAAGACA
GGTCACGGATTGGCGGAGGTAATTCTGTAAACAAATCCACAGGGTATAGTTGATTGACCA
CTTTCCCAGAACCAGGAAACTGTTGATTTTGAGCTAGCTGTGTAAATGAGTTAGCCCTAT
TGTTCAATTGTAGGTTGCCCATTGCATAAGCTGTTTGGTCGATTTGTTGTTGAGACTGCT
GTTGCTCTGCAACTATTGGCATACTTGCAATGTATGGCACCTGAGCTTGAGGGTACACCC
TCTTCTTATGATGAGACATTATTCACTGCAGCTGTCGATCATTAATGGAAGAAGGTTCAT
CAACCAAGCACACTGCAAATGAAGGGTTAGATGAAGAGTTCGACGAAGACCCTTTTAACT
GACGTATCATTCATCGTTGTCATCGCTACATCTATGTCCTTCGGGTAAGCTAAACAAAAA
GTGAAAAGTTCAATAAATAATAAGATTGAGAGGTAAGTGAAGTGAAGATAGATGTTAGTA
TCCAAGTGTGACCAACATGTTCAGGTGATTGCAGGCGAAA
Chromosomal Coordinates Chr XIV from 538173-539819
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator