Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CEF1
Systematic Name YMR213W
Alias NTC85
Description Essential splicing factor; associated with Prp19p and the spliceosome, contains an N-terminal c-Myb DNA binding motif necessary for cell viability but not for Prp19p association, evolutionarily conserved and homologous to S. pombe Cdc5p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CEF1	6323869 upstream sequence, from -1000 to -1, size 1000
ATTGCTCTCCAGAGCTGCTTCCAGCGACAAAGTTTTAAATTTCGGATTTCTCTCTTGGAA
CTTTGAAATAGTATAGGCAACAGACTTGGAAACAAAGTGGTTTAGTTGTGGGTTGCTTGA
AACACTATTTGTGTTTGATATATCAATACAGCATTTCAGAAGCATGTCATCATTATGAAT
TCTTTCAGTAACTATTTTAAAAAAAAGATCAACAAAGTTCTGGTATAACTGGACGAATTC
CATGTCACCGTTACACAAGACGTCGTCCAAGTTCTGGCATATACTACTAAATGCCAGTTC
TATTAATTCAACAACAGATACATCATTGTTAAAATTGTTGTTGGAAAGAACTTTGTTCAT
AATGTACAAAAAATCTTTAACAAATACATTCAAATTCTCCTTACAATGCAACACAATTTT
GTTCATTAAATCCAATGTAACGGCTATGTTCCCTATGCGCCGATGGTTCAAGTCGGAAGT
GGAACGCTTAATCAGGTAAGTGCTAACTTTCTCCAATTTACTACGCCTCGAGTTAACGTA
ATATAGCAAATATGAAGTTTCCGAAGATTTAGGCTTCTTATCTGTGGTCCTTCCCGTAGG
ATAACATTGATTGACCAGTTTCTGATGTTTTGGTGTGAACATCATCCGCATAGACAACTG
CATCGCAAACCACTTTCAGAACAATTGAAAATGAACGAAAGATGAATAATAGAGCGAATG
ATCTGGGTTCAATATACAGTCTGCCACTGAATTAATACTACTCCAATAGCGGGGTTGCTC
ACAATACTTTCAATTTATCCTGGCTGCCTGGCTTTTTCAACAAAACCATTACCTTCCTAG
TAGTTCGAACAAAATTTTCTTCCTCTTCCTTTGGCCGGGGTTGAAGTTTAATGAAAAATT
AATGCTATGAACTATTATGACAAAAAAGCATATGCGACTCAGGAAGATAGTAAAGAAAAA
AAGCAAAACATTTCTAAGAGGACTATACTAGCATTTCAAG
Chromosomal Coordinates Chr XIII from 693381-695153
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator