Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HSC82
Systematic Name YMR186W
Alias HSP90
Description Cytoplasmic chaperone of the Hsp90 family, redundant in function and nearly identical with Hsp82p, and together they are essential; expressed constitutively at 10-fold higher basal levels than HSP82 and induced 2-3 fold by heat shock
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSC82	6323840 upstream sequence, from -1000 to -1, size 1000
TTTAAAGAATATGGACCCTTTCATTTATCTCAACGTTATTAAAGGACTTACAACGCTATG
TGAATTAGAGCCAGAAACCATATTGCCTCTACTTGCAGAATTTTATGCTAACAAAAAAAA
GAAAAACAGATTAGATGATGTGCTGAAAGTTGGAGAAGTGTTCATCAATTACATTCAACG
TCAGAACGAATTGTTCCAGGGTAAATTGGCTTATCTGATTATAGATACCTGTCTTAGTAT
TGTGAGGCCAAATGATAGTAAACCATTGGACAATAGATGGCGTATGTCATCCATGTCAAT
CTTAGGTATGTGCCTTCAAATCAACGCCAGGGGTGTCTCGGATAGAATTCGCGATATGCT
GGATTGTGTATTTGGAATATTGCAATTAGAACAACCACAAAATCATTTGAAGGACAAGGA
TGATTCTTTTTTGATGAGAAGAAGTGCCGTACACTTGATACATGATTTGTTGTACAGTAC
AGGATTTGATTTACTTCCCTTTGAGTACAACTACGATAAGCTAAAAACACTATTATCTTA
CGTTCGTGATCAAGATGAAGATTACATGGTTTGTGAACAGATTGACAAGCTTTTAACCGT
ACTAGATAGTTTATAACCCATTACGCATTTGATTATAATTTGCTTCTTAGGCAAAATTAA
TATTTACGTTCTTTTATATTCTTTCTTTTTGTATTCATAGAACAGCAGCCATTACCAATA
GAAAGTTAAAATAGCCGCCGATGCATTTTATTACCCGCCTTTCTGTTTTCTGGGCACTTT
TCTTTCTAGAAGGTGAAAGAACAATTTTTCTCGTTTTCTCGAACTTCCACCAAGCGTTGG
GTAATGAGGGAGGAGATTTGTATAAAAAGAGTGGCATGTGAACTGCCTACCGTAAGTGAC
ATGAACACATGCATTATATTTTTTGTGATATATTCTTTCTCTTGTTTTCTTTTTCTTGAA
ACGCTACAGAACCAATAGAAAAATAGAATCATTCTGAAAT
Chromosomal Coordinates Chr XIII from 632355-634472
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator