Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALD3
Systematic Name YMR169C
Description Cytoplasmic aldehyde dehydrogenase, involved in beta-alanine synthesis; uses NAD+ as the preferred coenzyme; very similar to Ald2p; expression is induced by stress and repressed by glucose
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ALD3	6323821 upstream sequence, from -1000 to -1, size 1000
AGGATGAGATATTTGGCCCGGTTGTGGTTGTTAGCAAGTTCACAAATTATGATGACGCTC
TGAAGCTGGCTAATGATACTTGCTACGGGCTCGCCTCTGCGGTCTTCACAAAAGATGTCA
AGAAAGCGCACATGTTTGCTCGCGATATTAAAGCAGGAACTGTTTGGATCAACTCATCTA
ACGATGAAGATGTTACCGTTCCTTTTGGCGGGTTTAAAATGAGTGGTATTGGTAGAGAAC
TGGGGCAAAGTGGTGTTGATACCTATCTTCAAACAAAAGCAGTTCACATAAATCTCTCTT
TGGACAACTAATGTGATAGTTATCATTATGTAAGTGCGTAAGTACCTAAATAGCTTAGCC
TGACGACGGATGAATATGTTGACAGTCTAGCAAACAGTAGTAGTCCACTACTCGATATAA
AACTGTAAGCACCATTATTTCAGCATGCGGAACAATTGTTGTTACTAGGTCCTAGAAATC
CCTTAAGATGGTAAAAAAATAGAGCTATAAACTCAGTGAGATTTATTTTTGTGTCAAGAA
ATTATACTTGCGTGTTAGTTTTCTCTATTCCCACCATTACGTAGATCTTCCGTCTTTTTT
TTTTCTTTTTCTGCATATGACGTCTGTTCTTCCTTCCCCCCCTGGAGTACAAGGAAAGTA
TCACTATTAGAACTCTACAGTACCTTTCTTCCACGCCCTTTAGTGCATTTAGGGATTTTC
ATTACTGCTAATCCAAGACTTGAACCGGATTGTTGATCAGCCCCCTTCTTAAGCTGATTG
CTAAACTCCCTAAGGGTTAAGGAATTAGTAAGTTTAGGGAGGAGACAGGGAGATTGTTCA
AACGAATAGCGTAGATTTAACTGATCATACCTCAGAAACTAATTGTATAAAATGGCAAAT
CTGGATGGGAATAAATTTGACTCATGCCAGGTAATTATACCTTGGACTTGTATCATAGAG
ATATAGATTATACACATTTAGAAAATTAGCCAAAAGAAAA
Chromosomal Coordinates Chr XIII from 600872-599352
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator