Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SWP1
Systematic Name YMR149W
Description Delta subunit of the oligosaccharyl transferase glycoprotein complex, which is required for N-linked glycosylation of proteins in the endoplasmic reticulum
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SWP1	6323798 upstream sequence, from -1000 to -1, size 1000
CCGTTGAACCAAGCGGGTTAATTATTTTTTAAGGATAAAGGCTACCACAATCATGAGAGA
GACACCATGTACTTGCAGGATTCTGATATTTTTTCTATGCTTGTTTGCTGACATGCAGAT
TCGGAGCTGGTTTTGATATTTCATAATCACCTATTTTTGAAGCAATACTTTTGGACAACA
AGATAGCATTATTATTAGGATTTCCCTATCAAAGAGTCATTTCCGTGCACTTCGTGAAAA
ATCCAGTCAGAAAGTTCAGCAAGCAGTCAAGAATATCTACTTTTGTTTCCAAGAAAAGCC
TTACCTGACAGCGTTCAAAGTCTCCTTTGCCATTGGACTTGTTATTCCGTGTTCCCTACT
TTTTTTGATAATGGTTTCTACCGCTACATTTTTCTTTTTTGTTTACTTAACCCTTTTCGT
AGTGATAGGTTTCTTCTCCTCATTATTCATAATACCCTTATTGGGCATTTCCTTTGTGTT
TGCCATTGGCGTGGTATCATTTGGCTTCTGCAGCAACATGAGTTTCAAAATGGCCCAACT
CATTTATGTCCGAGCTGACGCCTTCTTGAAAAAAGTCCTCGACAAAATGGCCCTACAAAC
ACAGCCGGCACAACTACAGGAACCACAGGAGCCACTTTCCACATTAAGGCCAGTATCTAA
TCCAACTATTCCAAGCCCATTAAGACAAACGGCGCGCCCTTCTAAATTCGTCACCGAAGA
AGATGTTATTTTCGAACCTGTTAGTGCTCAAAGCGCCATTGCCCGTTCATTAGAGACTAC
TGCTAATAAAGCGGGTAATAAGTTCCAGCTCTCTTAACCTCGGCAATAAAAAAACATTTT
TCGCAAGTTTAGCAGGTCAATAATAATAATATCCTTATAAATTACACTCAGTTTTTTATT
ACATATGGGCCTTTAGTATATACATACGCATATATCTTAGCTTTACCGATCTTCTAATAT
TGCGGCCTATAACGCATAGACCATAAAAGAAACGGAGCAG
Chromosomal Coordinates Chr XIII from 560996-561856
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator