Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name REC114
Systematic Name YMR133W
Description Protein involved in early stages of meiotic recombination; possibly involved in the coordination of recombination and meiotic division; mutations lead to premature initiation of the first meiotic division
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>REC114	6323781 upstream sequence, from -1000 to -1, size 1000
TACATTGTCTTAGAGACTTAAATGATACTTCACCGGGATTCATATACCTGTTTTTTCTCA
AGTTATGCCATGGTGTTATCAAGATGGTGCATTGTGGCATTTTGTTTCCTTGAATGGATT
CTGATTTACATAGCTGCAGACAGTCACATATCACTTCTTGCGGTATGTCATCGATTGTTT
TTTCATTTGGGCGTAACTTTAAATAAACATGACCACTTGAGTACTTATCCGCGTGAAACC
AAACATAGTTTAACTCCCTATAGCTCCATTTGATAAGTAGATCGTTTTCAAACTTATCTT
TGCCCATCACAATTTGGTAAGGTGTTGAATACTCAGTTGGTTTTGATTCATAGAAATACA
CCATTGTTATTGAAAAGTTGAATTTCAATTGAGCCTTATAATTCTATTCGCTTACTTTCT
AAATTTTAAGTATAAGGCAGTCCTCTGGTCTACAGAGTTGTTTTGTTTTTTTATCCAAGT
TCTTTGTTTCAATCTTATTGTAGTTTTTTTCCATTAAAATATTAAAGCCTAGGATAATCT
ATATCCTAAACTAAATATAAATTAAGAGTATAAAAGATGAAAGTAAATAGCATCTAGCAT
TCAGAAAAAATAAGAAGTCTCTTTTCAAATGATTGATCGAGCACAACGAATGTTTTCAAA
CCACTGTTAATTTTTTTATAGATGTAATGACTACTTATATGTTCTACGATGTGATTTTGT
AGGAATAAAATAAAATTCAGTTTACCGTCTGCATATTCATAAACACTTAAATGACTGTTA
AAGTATTCAGTATTTTAAATAATAATAACATAAATTATTAATACATACTTAAATACGAAG
CCCATTTTGGTGGGTTCCTGAAAGAATATCAACTTTTTTTTACTAATAGAGAATTTCGTT
ACAAGGTGGGCGGCTAACTTATAAAAAGCAAAGGAGAAGGTTTTAACATATCGTCAAGTT
AAGTTTGAAAGAGAGAACTAAAATAAAAAAAAAGAGAAAA
Chromosomal Coordinates Chr XIII from 536207-537448,537565-537609
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator