Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SEC65
Systematic Name YML105C
Description Subunit of the signal recognition particle (SRP), involved in protein targeting to the ER; interacts with Srp54p; homolog of mammalian SRP19
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC65	6323531 upstream sequence, from -1000 to -1, size 1000
TGCGAGAACTATTATCTATTTCTGAAATATGCGAAGATAACATTTTCAGAAGATTTTTGA
CAGATCCTACCCCATTCAAACTGAACAAGGAATATATGCATGATGATATTCTGGAGGAGC
CACTTCATGAACCTATTGGTAGTAGTAATAGCACAAGTAATAGCAGTTCTGTTGTTGATT
TACAAAGCTCTGAAGACGGCGGTGAATTGAATTTCTATGAAGATGAAAGACATTTTTTCA
CCGATTCTGGCTATCCTTTTTATTCGCAAAATAAATCTTTTGTTAAACAGATATGTGACT
TATTTATTTCGCTCTTTGCTTTAAATAAGGCCAACGCGGGTTGGTTAAGAGGAAGGGCTA
TAATTACCGTTTTACAACAGCTTCTTGGGAGCACTATTGAAAAGTATATAAAGGTCAGCA
TTCAAAAATTGAGATCAGAGGATCAAGTATTTGAAGCAATAGTTACATTCAAGAATATGC
TATGGGGTGATAACGGTCTGTTCGAAAGAAAAAGAAATGAAACGGCAGAGGCAACAAGAA
GCGAAGGTGAAAGGTTACGGACGGAACAACTCGCTTTAACCAGTTTGCAAAGACTCTTCG
CAGACACTTGTGGTCGTGTAGTTGGTCTAAGAGATTCTCATGAAGCTGCTGGCCGGGTCC
ATGCCATGCTACAGAATCCGTATTTAAATGCCAGCTTACTGTTGGAAGCTCTTGATGCAA
TTTTATTGGACATAATATGTAATGACTGAAAATAAAACTTGACTAAGTACCGAACAATCT
AAAAAAAAAAGTGTAATTGTCACAATAGCAAATAAATTGGTACACTTCTTCAGCCGCTTT
AAAAATTGTGTACTTCTTCTTAAAACAATTGGGAAGTATTTATTTTTCACGCTTTTGTAA
TCTGAAAAAAAAAAAAATATCAATGATATTCAACAGGCTAGCAACTAACGAAATCAAAAG
AAATAAAATAAGCCATAAGCTATAGTATCATAAAGTCAAA
Chromosomal Coordinates Chr XIII from 58687-57866
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator