Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GLO1
Systematic Name YML004C
Description Monomeric glyoxalase I, catalyzes the detoxification of methylglyoxal (a by-product of glycolysis) via condensation with glutathione to produce S-D-lactoylglutathione; expression regulated by methylglyoxal levels and osmotic stress
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLO1	6323639 upstream sequence, from -1000 to -1, size 1000
TTATAACAGAGGTCATGTAACGGCAGTTTGCTCTTGACATCGTGGTAATTCAAAAGGTAT
TCTGAAGGAGGTGCTAGGAGGATAAACCTACGGGTTTTTAAATTAGCGAAAAGCTTTTTC
AATGGGGATCTTTCTGGTTCGGGACAGTTAAATATAGCATTAACCAGCGGGTTCAACAGC
GTTGGTAAATGGTAAACTGACATTGTCAACCCTAGCTAAGCCATAGCTTTTCCGTTGAGG
AATTTACAATAAGGTGGTTCCTTTAGTTATAAATTGCAACTGCCAAAATTTTCGGGTAGC
GGCAAAATTAAACGAAAACCTTCTGTCATATTAAACATAGTTTAGTGACGCAATGCACAC
ACACTCATATATATGTATATATTTATCTATATCATAGGTGTAAGGCAAAGTTATCACGTG
AATATACTGTTTAGTATACAAGTACGTTGATTTAACGGCTGAGAGATTCTCAAACAAAGT
AACGCTTAGTTTAGCTAAAGTAGAATCGAAGCGCAGTGAAGGCAAGACGAGTTATCCCTT
TATCACAAAATATAAAAAATAGGTAAAGAGGGGGGTGGGGGTGGTTCGGACTTTGCATCT
CGGTGCATTAGTACCACTCAGCTTCAGTTATAGGAATACTGACAATGTTCTTGAGCCAGG
GAGAACTGAAATTTCCATACCCTTTAACCCTTTATTCTTGAGCATATGATCTTATTTTTC
CACTCAGCACAAAATACACATCCCGCATATGATCTGGACACTGAATAAACAAGGGGCTTT
ACGATGGAGTAGTAGACCTGGATACGTAGTCACCACAGGGATCCTAAACTGCGTCATAGT
AAGTTTCTTTGATACTAGAATGTCCCTCTCTCGTAGTAGTTGATATCCCGTATTTCTAGT
TAGTGACGTTTATAAATAGGGAGAAAAAAAATCGGAATAACATTTCCATGCCTTTTTTTT
GACACTTCAGACCAGATACGCCACCAGCTACAAACTAACA
Chromosomal Coordinates Chr XIII from 262685-261705
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator