Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SMC6
Systematic Name YLR383W
Alias RHC18
Description Protein involved in structural maintenance of chromosomes; essential subunit of Mms21-Smc5-Smc6 complex; required for growth, DNA repair, interchromosomal and sister chromatid recombination; homologous to S. pombe rad18
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RHC18	6323415 upstream sequence, from -1000 to -1, size 1000
AAGAAAATCCATTGGGTGAATTTATAGTATTCGGGATCACATGTAGTTATTTCTCTGTCC
CAATCAAAATTTGCCAGCATACTTTGCATTTGTTGTTTCATTTTTGCAATATTGTCCCTA
GTCCATATGGCCGGATTAATGCTTCTTTCTATAGCAGCGTTCTCGGCAGGTAACCCAAAA
GCATCCCATCCCATCGGATGTATCACGTTGTACCCTTTTTGTTTGTAAAATCTATTCAAA
GAGTCGCTAATGACATAAACTCGGAGATGTCCTATGTGAAGCGCCCCAGAAGGATATGGA
AACTGGCACAGAATATATTTCGACCCGCTATTCAGAGTATCCTGCTTAGGCAAGCCACGG
GTTGTCTTCTGTTTCCATTTCTCCCCAATTGCAATTAATTTTTTCACTGCAGGTCCAGGG
CCCCTTTTAGTGGATAGGAATCGGCTTGAAGGTCGAGACAGCATTTTTCCACCGTACACA
CACGTCGATTTATTCACGTACAGACTCTACAATATAGAGTACTAGCGCCTTGTTTAACAC
TCTGCTGTGCTCCTTCCTCCAAGTTCTTGATTCTCCACCGGAGCAACAAAACGACTTTCT
TCGGTTTCTTTGATTCTTCGCGGAGATAAGAAATGAGATTCTTGGATCAAAAAGTGTGTC
AGAGGTAGGGAAATGTCAAGCAAGTTCATGAACAGACCAGGAGTAGTATGGCATGGTATT
AAAGATTTTTCTGTGGTATTTGATAGTTAGGCAAAAGGAACATTTTCATCCAAGTTTTAT
CAAAATTTCTGTTTTATAGTGAAAATTCTAAGTTAAACTTGCCAAAAACGCGTCGCGTAT
ACTAAATTTCAATGTTTGGATCTATCAACATGAATATTTATATTTCATGTAGTGAAGTTC
ATAATAAGAAAAAAAGACAAGAGGCATATAGGTTCGCAAGAGATAAGTAGCTGCTGTTAA
TAATAATAAAGAGCATATTCTTGTTAGATTGCTAAATGGT
Chromosomal Coordinates Chr XII from 885288-888632
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator