Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RMP1
Systematic Name YLR145W
Description Subunit of RNase MRP, which processes pre-rRNA and has a role in cell cycle-regulated degradation of daughter cell-specific mRNAs; unlike most subunits, not shared between RNase MRP and nuclear RNase P
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR145W	6323174 upstream sequence, from -1000 to -1, size 1000
AAAATCTTGTGGAAAAGAGTAATCAGGTGAGGTCAAATAAAGTATCCAATTCCTATTATT
CTCAAGTTGTATATTATATTTACCATATCTTTCATTCACGCTTATGCGCTCTAAGCTCCT
GAAACCAACGGCGCTTCTTAATTCAAAACCCAAATCGTGGTAAATAGCCGTGACAAAGCC
CATCCCCTGAACCAGCGGGAATTCTATAAACTGGGAACTACTCAAAGACATTAGTAAGCA
CATGGACATATGTTTCATATCCCGGAATTCAAGCTTGATATCATTTGAAGAGACAAATTC
CCTGGCCTTGAATACAAATGATTTTATATTTGTGGGATTGAAGTAGAATCTGGGAGGATT
TGTAGTTGTATCAAAAACCCTTTGAGACGCTAAAGTATGATTGGCGGCCAAACCAAACAA
TTCTGGATCACGAGAAAACCAAATTGAATAAGGATGTGTCCATATAGGTTGTGTATTATC
GTCTAATAACATGTTTGTGTAGAACTTGTTTGTCTCCAATGGATCAACAGATTGATCATC
AATATTCGGCTTTGGTACCGGGTGTTGAACTTTGTTGAAGACGGAAGGAGGAGCTTTTAA
GTTAGAAAGGACAGGTGATTGAAAAATATTGTCACTATTCACCTGGCTGTCAGCTAAAGG
GTTAGAACTGCTTGGTGTGCGCAGTGATTCACCTGCCACCCTATTTTCTCGAGGTTTACT
GGAGTTCTCAGAAGAACAAACTGGTGGCTGAACATTTGCGCGAGGTGGTAAGGGAGGAGG
TCCTCTATTGGTAGTACCGCCAGGTCTATTAGGAACAGGTGGAGGAATGGCTTGCCTACT
GTAACACATCTTTTTACTTCTCGTATTTATTTATTTTTGTTTTTATGATACTAGCACTTT
TCAGAAATTCATGAATTTTATTTATGGTTCCAAGAAAAAAACTTCAAAGAAATGAGTACT
AGAATGATATATCCACAAAAAAAAAAAGAGCAGAAACAAA
Chromosomal Coordinates Chr XII from 432168-432773
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator