Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL22a
Systematic Name YLR061W
Description Protein component of the large (60S) ribosomal subunit, has similarity to Rpl22Bp and to rat L22 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL22A	6323090 upstream sequence, from -1000 to -1, size 1000
TTACCATTGACCTTATGTTCGCACGATGAAAACTTTAAATTTCTAAGACAATCCGACAAT
GGTGATTTAGCTGTCAAATTGGCCAACCCAAAGACTTTGGAATACCAAGTTGTTAGAACC
ACTTTATTGCCTGGTATCTTAAAGACAGTCAAGGAAAACAGAAAACATTCCTTGCCAATC
AAAGTCTTTGAAACCGGTGACGTTGTATTTAAAGACGACAAACTAGAAAGGAAGGCGTAC
AATGAACGTCACTGGGCTGCCATCTACGTGGGTAAGAATTCTGGGTTTGAAATCATTCAA
GGGTTATTGGGTAAAATCATGCAAACTTTTAGAACAGAGTGGATTGCAGACTACGGTGCT
GCTGCTTCTGGCAGAGGTTACTGGATTGAAGAAGACGATTCTGTGAAAACCTACTTCCCA
GGTAGAGGTGCCAAGGTCATGTTCAGATCCAAAGAAGGCGCTGAGCCAAAGCAAATCGGC
CACTTGGGTGTCTTGCATCCTGAAGTCATGATGAATTTCGACGTTCCATTCGCTGCATCC
TTTGTAGAGGTTAATGCCGAAGTCTTCCTATAATGTAATGTTCTAACAAAAATTTTTACT
GATTTATAAAACTTATATAGATAGATAGACACATATATATATCTATATATAGAAACACAA
CTAAAGTTTACCATGTTTTATATAATATTACTACCGCTACTGAGTAAATGTTTAGCTTGT
ACTTAACTTTCAAAGACAGTTTTTTTGATAAACATCAGTACATTTAATAATACATCCATA
CATTTATGTTAATTTGTTTTTCCTTTCCACCTCAGTGCGCTTCTCTTTTGAAAAAATCCT
CAACAGGCCACGCGAACAAATCTTACCGAGAATTTCCTAAAATGTTTCAAACTATCATTT
AGCTGCATACAATATGTACATTATTAATTGAGATTAACAACTTTACCTGTACTTTACCGT
TATCAAATTATAAACCACCAAAACAACAGATTAAGAAACA
Chromosomal Coordinates Chr XII from 263194-263205,263595-263948
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator