Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ATG10
Systematic Name YLL042C
Alias APG10
Description Conserved E2-like conjugating enzyme that mediates formation of the Atg12p-Atg5p conjugate, which is a critical step in autophagy
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>APG10	6322986 upstream sequence, from -1000 to -1, size 1000
CGAATCCAAACAACTCAAGATCTATCCATTACCCCACATGTTTATTGTCAAAGATTTGGT
ACCTGATTTAACTAACTTCTACCAACAATACAAATCTATCCAACCTTACTTACAGAGATC
ATCGTTTCCAAAGGATGGAACGGAAGTGCTACAAAGTATTGAAGATCGTAAGAAACTGGA
TGGTCTTTACGAATGTATTCTGTGTGCATGCTGCTCTACTTCATGTCCATCGTACTGGTG
GAACCAAGAACAGTATTTGGGCCCTGCCGTGCTAATGCAAGCCTACCGTTGGCTAATTGA
CTCTAGAGACCAAGCTACAAAGACAAGAAAGGCCATGCTAAACAACTCCATGTCATTGTA
CAGATGTCACACCATCATGAACTGTACTAGAACTTGTCCAAAGGGCTTGAATCCTGGTTT
GGCTATTGCTGAAATTAAGAAATCTTTGGCATTTGCCTAGACTATCAGAAAAACAGCTAG
CCCCGAAGAACTCAGAAGCCTCTCAAATGATTTTGGCACTAATAAAAGCACCAACTATTA
TTATTATTATTTTCAAGGACGAAACTCACCATTCTCACACATTCCTATACGTTAGGCGTT
TATGTTTACTCTCTATGACTATTATTTATTTATCATTGGCAATGCTATGACCCGGTCTGT
ATATATGTCCATCATAGGCGACAAGGTGTTCTAGTATCTTCAGGTATTGTTGTTTTTAAG
GATGAATTTATATCTTTGTTTTTGAAGGGCCTTTTGGCTTCTCTCCCCTATTTATTCAAT
TTATAACTATTTATTATATTAATACACGCGTAATGCTTAAGGTTTATTATTAAAGGACTG
TTTTTATATTTACATGCCTGTAGTTAATTATATTTTCGTTGTGAAATTTCTGTTAAGAAA
CTCTATATGAAAGGTAACGAACTTAAAATTGAAAAGCAATGAGAAGAGAACACCATGAAA
AAAAAAAAAAAAGGGCTAAAAAACAGAATTATCAGACTTG
Chromosomal Coordinates Chr XII from 52590-52087
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator