Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HBS1
Systematic Name YKR084C
Description GTPase with similarity to translation release factors; together with binding partner Dom34p, facilitates ribosomal subunit dissociation and peptidyl-tRNA release when translation is stalled; genetically implicated in mRNA no-go decay
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HBS1	6322937 upstream sequence, from -1000 to -1, size 1000
CTTTTATCCTTTCCTCACGCCCCGAATGACCCATACCAGAGGTATTTGTATTGTCTTTGG
GCCTTCTTGTGTTTTATCATCTGCAGTCATCTCATGAATTTTTCAGCTTTCACCGCTTTT
ATTATTTGAGAAAATAGAAAAGAGGGCAAAAAGAGATACTTTCAACAAGTTAAAATGGAA
AATTAAAGACAAAGTAAAATAGCACAAGAATGATTGGCAGAGGTGTGTGCTGCAGATCGT
TCCACACTGCTGGATCTGCCTGGAAGCAATTTGGATTTCCCAAAACACAAGTGACAACGA
TTTACAACAAGACTAAGAGCGCATCTAACTATAAAGGGTATTTAAAGCACAGAGATGCTC
CAGGAATGTACTATCAACCATCAGAATCCATCGCAACCGGATCTGTTAACAGTGAGACCA
TTCCACGTAGCTTTATGGCAGCCAGTGACCCTCGTAGAGGGCTTGACATGCCTGTTCAAA
GCACTAAAGCGAAGCAGTGTCCAAATGTTCTCGTAGGTAAGAGCACAGTGAACGGCAAAA
CCTATCATCTGGGACCTCAAGAAATTGATGAGATCCGGAAGTTACGTCTTGACAATCCTC
AAAAGTATACACGCAAATTTTTGGCTGCAAAATATGGCATTTCGCCATTATTTGTATCCA
TGGTCTCGAAACCTAGTGAACAACATGTACAAATTATGGAAAGTAGATTGCAAGAAATCC
AATCACGCTGGAAGGAGAAGAGGCGTATAGCCAGAGAGGACCGTAAGCGTAGAAAACTCC
TGTGGTACCAGGCGTGAATGCTATATAAATATAATAACAATCGTGTAAATACTACTCTAT
AAGTACTTCGTATTCATATATTGATCACAATGCACGGAGACGCCCATTAATGTGACTTGA
ATATACCACATGAAAGCTAACCAATAAGCAATTTAAAAAGAGTTAAGTACAGCTTGGAGA
CACCCAAAGGCTTCTGCTTCGACAACTATTGACTATCGAG
Chromosomal Coordinates Chr XI from 598890-597055
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator