Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CCP1
Systematic Name YKR066C
Description Mitochondrial cytochrome-c peroxidase; degrades reactive oxygen species in mitochondria, involved in the response to oxidative stress
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCP1	6322919 upstream sequence, from -1000 to -1, size 1000
GTTTGCGACATTACCAAAGCCGGGTCGATGAACTGATTTGCATGAGGGGCACACACAAGG
ATGGTTGGCACCCCAACTTCGGGAACGTTATATGCACCACGTACCTTAATTTCTCTGAAG
AAAATAGTGAACAAAATATTAAACAGAAATACAGACACATCATACAGCCATGTATGTATA
TTGTATACGAATCCATTGTATGAATTTTTGTACCGTCGGGACGCTTGAGGTACATGAGGA
ATAGGTTTGGCAGCGTTATGATCGGCAGCGGGAGCAGACATAAAGGAAAGGGAGCAATAA
CTGATCGATTAATCGGCTTTATTAGATGTGAAAGTAGAATTTTGCTCTAGCGACGAAGCA
CGAAAAGACACTATCTTATACTCAAGCTGCCACTTCTTCAGGGTCTCTCCTCTTTTCTCT
CCCCTCTTTATTACTCCTCTCAACCTTACAATCAAAGTGAGCCATTTACTTCGAAAATGC
GGAGCAACGGCGGGTTACTGGTGTTCCAGCAAGAGCTGTAATAATTCAATATAACTAGTA
AGAATAGCCAAGAAAGCCAAAAGACGAGCTTGGATCGATGCGAAAATGTGGTCGCTCCAC
ACCAATTACTAGTTATCATTTAGCGCTGCCGTGTGGCGACTACACTTCAGCGACCTATGT
AGCTTACATAATGTCGGGATGATTTCTCCCGCAGCTAGATCTCGCCAATGGAAATTCCAA
AGCCAAAGAATATCCTGCTTTGTCAGGAATTTCGTAAACCATGGTCAGGCCCAGATTTGT
AGTTTTCTTTACCAACGACAGCGATGAGTTATTTGGTCCTGAGTACTGAGTAATATGACT
CTCTTGGCATCCAGGGGCCGGCCCAAGCCGGCTGTTACCAATTTAGGAAAGGACCCTGGA
GCGAAAAGTACTTAAGCAGAGACTATTGTACACGCTCGCTAACTCAAGAACATGAATTTC
GCATTCATGCAGACGCAAACACACACGTATATCTACAATT
Chromosomal Coordinates Chr XI from 567198-566113
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator