Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TEF4
Systematic Name YKL081W
Alias EFC1
Description Gamma subunit of translational elongation factor eEF1B, stimulates the binding of aminoacyl-tRNA (AA-tRNA) to ribosomes by releasing eEF1A (Tef1p/Tef2p) from the ribosomal complex
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TEF4	6322769 upstream sequence, from -1000 to -1, size 1000
TAGATTCTAATGGTATTTCATTTCCCTCATCATCAAAGATCACCTTAATATCCTCTTCCT
CTTCTTCATCTTCGTCTGGTGCTATTATCATAGGATCGTTTACTTCTACGTTCAGGTCGG
AGTCTCCTTCCACTTTTGATGTTGCTTCCTTTTGCTTTTGCATTTTCATGTGCTTGAATT
TTTCACCAGGTAGGACCACCGGCTTTGCGTCTTTCTCCTTCTTCTTCATTACTTCTAATG
TACTAGATGTTTCATCATCACGTTGCTCCGGGTCTAATTTTTTCAGTTTATCATTTTTAC
TCTGTTCTTTGGTTTTCTTCTTGGCCTTCCATTGCTCTTGACTTTTTTCATCATAATAGT
ATTTTGCAGGAATTAAAGCCAATAAACCATCGAAGGCGCTTGAATTAGCACGAAGGCGCT
CCTCAAGTGAATTACTCATCTCAGTCTCCTATATCTTTCAATTCCCGGACTTTCTTTATC
ACTTGCAACAACGTCTCAGTCCTCACTTGTTATTCATCTCTTGGTCATCTCATCTCTTTT
ATTGTACTTTCCTCTTTTCTTTACCGGAGATGAGAATAAAAAGAATTCATTTTAAAAAAT
TTTCAATTTGGTGTCTGGGTGAAACTTTTTAATCGTGTAATCCCAATTAAACCACTCTAC
TTTACTTTAATTGGTACACGAACTCATTACACACCTTTGCCTCTATTGCTTGTGTCAATC
GTGTTGAGAGAGGAAGCCCAAAACAAGGGAAATTAACCTCTGTAGGCAAGCCATCACATT
TGGCAATAGCAGCCCTCATTTAATTTAATTCGGCATGTGGCCGGCAGGGTAATGCGCTCT
GCTGCTGACAAAATTGAAAGAAAAATTTTTTTCATCAACAGTTTGCAATACTTTCTTTTT
CATATTTAATTCATCCATTCCGTCGTTAATTTTGTTCAAAACTGGTGTCCATCCTTAATA
CCAACTCAATTCTTTGATTTTGGCCCTCGATAGATTCAAG
Chromosomal Coordinates Chr XI from 282891-283095,283422-284455
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator