Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ARP3
Systematic Name YJR065C
Alias ACT4
Description Essential component of the Arp2/3 complex, which is a highly conserved actin nucleation center required for the motility and integrity of actin patches; involved in endocytosis and membrane growth and polarity
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARP3	6322525 upstream sequence, from -1000 to -1, size 1000
TAGAGTAAATAAGGACAATTCTCTGCCAACGCTGTTATAATCAGAAGCGCAGCATGTTTA
GCATGGTCTGGCTTCGAACTCGAGAATGAATTCTTTTCCGTGGAGGCAGTAAGCCATTCT
AAGCAAGACTTTATCTCAAATTCCACGAAATCAGAGGTATATGTACCTCCTGGAACGGCT
AACTTGCCCAGAGTCTTTGCAGCGAGTCTCATGACCTCTACATCATTAGAAGGTATTAGC
CCTCGAAGGTAACCAGCCAGTCGTGAAGTTTCGTTAGGCAACCTTTCAGTATATGCGTAG
AATGAAATCAAAGTGTCTATGGATAGAACAGCCCCTACCCTAGTGCTCGTTTTTTTTGTA
TGGACCAGCTCCAAAATCTTATTGTTTATGTCATTTGAAACTGCTTGGAACTCTTCTATC
GACAATTCATGTTCCAAGGATACTAGTAGATCAAATAATGAAATACTGGCCAATTTTCGT
TCCTCCTTGTAATCACTGGTTAATTCGCGGAAAATTTTCTCCAAAATGGGCTTAAAATTT
ACATCCCCATTACTGCCAATCACCACTCCATCAAACCTACTAGAAGTCAGACCGAATTCA
TCCCCGTTCCTGCTCGCATTCATTTTCATGTTCATATTCACATTCAGATTCGGTGCCAAC
GGCACATTTCTATCCATGTCCATATCGTTGTTAGCCGCTTTCAAAAGTTTACTCTTCCAA
ATCTGCTCCTCATGCGGTTCCATATCAATGCAAACCTGCTAGCCGGTTGATGTATGTTTC
ACTTTACCAATGACTCTCTCGTGAAGCTACTATGGCTCTTTTTTAACGTAAGCTCAAGAA
GACCCTTCGATAAGGACTTTCAGTAGTCACCCGGCTGTCCGCGGCTTCAAAATGGCGAGA
ACCCCTTTTCAAAAGTTTCAAACAAAAATATATGAGAGTAGTTTAATCAAGAATTGGCCC
TACCGTAAGGCCTCACGATTGAGCAAGAAATTAGGATTCA
Chromosomal Coordinates Chr X from 559158-557809
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator