Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BIT61
Systematic Name YJL058C
Description Subunit of TORC2 (Tor2p-Lst8p-Avo1-Avo2-Tsc11p-Bit61p-Slm1p-Slm2p), a membrane-associated complex that regulates cell cycle-dependent actin cytoskeletal dynamics during polarized growth and cell wall integrity
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL058C	6322403 upstream sequence, from -1000 to -1, size 1000
ATTATCCAGGGGAGACCAGTTTCTTCTTCTACGTTGCCTTCAAGATCGAGTCACACATAC
AATGAATACACCTTTGCTTCCGATATGTATTCTCTAGGAATGATTTGCTATTTTATTGTC
TTCGGTGAATTGCCCTTTGAACCACAGTTGGATATAGTTGATTTGAAGGTACGCATCAAA
AATTTTAGGTTCGACACTGAAGGTATGATTGAAAAGCATCAAGCGATGAAATTGAAACCA
ATAGACCGTAGAATATTTCACCTAATGGACGCTCTTTTACAACCAAATAATGATGCTAGA
CCCACAGCGAAGACAGTGGAGGAGACGTTAGATGAAATGCTAATAAATTCCAAACCCGGC
AAAAAATTCTGGAAAGAAAATGTGGATAGCACTTTGAACTTCAGTACAATCTCGGAAGTG
AATGAGAATACCAACAGTTTTACTGATGATTATATTGACGGAGACAACGTTACTTTATCA
TTACCAGCACCAGAGGAAAATTTGAGCACCGTATCAACCCAAAACCTCCAAAAGTATTCT
GCTTTAAATAGAACAATCCAGGTTTGTTACAAACTAGTTTCTATGATATTAACGATAATC
ATATTTAAGTGTACCAAAACGGGGTCGTGGCTCTCTTATATGTCACTGATATTGTTGGGA
ATGGTTTTTAAATCACCAGCTGATGAAAGAGGTAAGCATGCAAGAGCGTTGGTTTTACTG
GCCTTCATCGCCGCATGCAAAAAATACATATACTAACAATAAGTACACATTGCAAACTAA
ATAGCACGTAATTTATTTTTACTTTACAAATTTATAGAAAATATTCTCGCTTATCACCAA
TGTTCACGAATCATCTTCACCTCTTCTAAGGGCCGGTGACAAAGGTGCATAATGTTAGAA
AAATTGACCGATGAGTAAATTTATAGAGGGAATAACCAAATGAAAAGATCTAGGTGACAG
AAACGCCAATTGACCTCTGTAGAAATAAAGTTCTTTCATT
Chromosomal Coordinates Chr X from 327873-326242
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator