Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ATG32
Systematic Name YIL146C
Alias ECM37
Description Mitochondrial-anchored transmembrane receptor that interacts with the autophagy adaptor protein, Atg11p, and is essential for mitophagy, the selective vacuolar degradation of mitochondria in response to starvation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECM37	6322045 upstream sequence, from -1000 to -1, size 1000
ATGGTGGACGAACTGTTTGTTAATACAAGGCTACAAATGATGCCTATTGTAAGAAACAAT
AATGGACTGGCTCTGAGTAGTAGAAACAAATATCTTTGTCCAGAGTCTTTAAAGATCTCT
GAAAACCTTTACCGCGGGCTGAAAGCTGCGGAAAATGCTATTAGGAGACTAGCACCAGGG
GGACGTCTCTCCAGATCAGAAATCATCGATACTGTGACTCAAATATGGGCACCCTACGTT
GATTCCCACGATTTCAAAATCGACTATGTTTCCTTAGCAGATTTTAAGACTCTTGATGAA
CTCTCCGATGTTGAAAACACCAGCGAACAGCAGCCAATAGTCATTAGTTGTGCTGTATAC
GTGACTGACCGCGAAAAACCCGATACGGTCGTCAGACTAATAGATAACATCGTTATTTAA
ACTAGGTGATTGGGCCTTCCCGTGTCTGTGTTGCAGTATATACCACTCTTATACAGTATG
CACGATATTCTTTTAAACCAACAACGGGATGATAGATTTCACGCTTGATGACTTTTTTTT
TAGACGGCTGAAGGGACGACATCCCCATCGCTCAAAACACAAATATGGAAAGGACAAATC
GTCTTTCACAGTTTGCATAGTAAAAGCAAAGTTTATACTACTTCAGCAAAGTTGAAGTTG
TTTGGCACTTGTTTCGTGCTTTCTCAAATATCTTAGATCACCGTCTGTCTAGAGCATATA
TCTATTGTTTGACGCACCCCTTTTACAAAAAAAAAAAAAAGAAACAGATCTATTAAGTAA
TAAAAAAGTTATTTAGGAAATAAGGTGCAGTAAGCTTCCTGAGGCATAATCATTATACTT
TTAAAATCTATATTTTTGGGTTATTGTTGAAATATTTTCTTACAAAGCCCATTTCTCGTT
TTTGACAATTTTTCTTATCAGTTGTGACTTCTCTTATCGATAAGCAATATTGAAGTCCTA
ATCACAAAAGCAAAAAAAATCTGCCAGGAACAGTAAACAT
Chromosomal Coordinates Chr IX from 75773-74184
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator