Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FLO5
Systematic Name YHR211W
Description Lectin-like cell wall protein (flocculin) involved in flocculation, binds to mannose chains on the surface of other cells, confers floc-forming ability that is chymotrypsin resistant but heat labile; similar to Flo1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLO5	6322005 upstream sequence, from -1000 to -1, size 1000
CCTCTTTCTTTTTTGTAAAAAATTCTGTTTTTAATAGCCAGTTCTTTAGTGATTACAGGT
AAGAGGGTTTCATATTTTAGAAGTGCAGCCATGATGAAGCACTTTTGCTCATTTATTGCG
AGAAGTTTAATAAGTAGTATGGTTCCATTTTCAAGAATCGAGGCACTGTTCCTTCCCAAC
CTTGGAATCATACTCCGAAAGGATTTCAAGCCGATTTAAATTCACCTGGTAACTTTCCTA
CGGTTTGGCCCAAGGTGATTATAATTAACTTGCGGCTTGTTTTCAGCCTGCGATCGAACC
TTTTTTACGCAAAAAAACCTTATTAATTAAGGTTTTGAAAATTTTCTTCTTTCCGGGAGA
TTTTCATGTAGCCTCGAGCTTCTGGATTCTCACGGGATTATCTCGCGTTACATTTTTTAC
TTTCTTCTTTCTTTTTGACTTAGGATATACAGATGATACGTCATTGTGTCATAAAACCCG
CTGTTGTGCAACAAAAGGGAAAAAGAAAAATACTCCTTTTTAGGTCTTATAAATATTTTT
AGCAGCCATCAAGTCCGGCTTTCAAACTTAATTTCACCCTTTTTCACGGCACCCTCGAGA
ATTACACTTTGGTTGCATGCAGGAGTACGCGAAATGCAGCATAAGCTACACATCTATGCG
TAGATCGCTTAACCTCTAAAGGCCGTAAACTTTTATTTTGTTTTGCGCTCATTAAAACCT
AGTGGGAGCTGGTAGGAAATAAGCTAGTAGCTTCTATGGATAGAATGGAAATAAACGTAG
GTGTAAACACTATTGGTAGAGAAGTTCCTCTGGTCAAATTTTCATGGGAGATACGTTAAA
TCTTTCACAGTCTTATCGTTTTGAATCACTGGACGGTTCTGGTATTCTGCTTCATATTTC
GACAAGATAATAAATATAAAAAGAGCACCCTCATGATTTCTTGCTCTGCAGTAAATTCCG
CAAATGATTTTCTTTAAATTGATTAGCACCACTAAAAAAA
Chromosomal Coordinates Chr VIII from 525392-528619
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator