Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name KOG1
Systematic Name YHR186C
Alias LAS24
Description Subunit of TORC1, a rapamycin-sensitive complex involved in growth control that contains Tor1p or Tor2p, Lst8p and Tco89p; contains four HEAT repeats and seven WD-40 repeats; may act as a scaffold protein to couple TOR and its effectors
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KOG1	6321980 upstream sequence, from -1000 to -1, size 1000
TCGTGGGTGTTTGAATTTACTATGAAGTCGTATTCCAATGACCTGCCGGACTTTCTTTTA
TTAACAAGTCGTAATTGAAATATATCGTTATTTAACCCGCGAGGAATTCTAAATTCGTTT
AACAATTCACTCACCTCCTCAGTATCGAGAGTGCCTGTTAATACCACATCAATATCTACT
ATTGTAGTGGCCATAAACTGCAGTAAAGTCAACTTATCAGGATAATTGTTATTCCAATCA
GGTATTACCGTACGGTTCTCATCTTTGATGTCTTTATGATAAGTCGCAACCATCGTGCAG
TGAGGAGAGGCGATCTCAGACAAAAACCTTGTTATGTATTCTGTAGAAATATAGTTCAAT
GAATCGATAATGACCATGTGCTTTTTTGCCTGTGTGGCAGTAGCAGCCGGTAGATATGAT
ATAATTTGTTTCACTAAATGTACAAAATCCATCTGCGTAGCGTCAATAAATTGAGTACAG
TACGATGGTTTATTCACTGTTTCGAACGAAATGTACACAATTGGATACTCATTTCCTTTA
CTCTTGCTCTGGTGGACGAATTCTTGGATGAGCTTGTATGAGGTCTGGGCAATAGAATCT
AAGCACAAAATGAAAGGGGAGCTTTCTGTGAGCGATAAGATTCTTTTCAAAAGAATGACA
GGGTTATGTGACGAACTGGCCATTATATCTTGTTCTACCTGTAGCAATAGCTTGGGTTGG
AGCTATTAAAAAGCTCTTAAGTTATCATTCTCCAGAGGTTATAATGGCATCGCTTCTTAT
ATTTGGATTTTTCAAGGTGACCCGCACTATGAGATGATAATCAAGGCAGCATTAATAGTA
TCAAAAATACTTTAATAAATCATCAATAGGTAGTACTTTACATAAGTATATAGAGGATTT
TAAAACTTGTAAAGTTATTTTCGAATGCATTTGGTTTGTAGATTCCTTTGATTACATTTA
GCGAATCCTATTGCATGCAGAGAAGGGTAAAAGATACATA
Chromosomal Coordinates Chr VIII from 480672-475999
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator