Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name IMP3
Systematic Name YHR148W
Description Component of the SSU processome, which is required for pre-18S rRNA processing, essential protein that interacts with Mpp10p and mediates interactions of Imp4p and Mpp10p with U3 snoRNA
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMP3	6321942 upstream sequence, from -1000 to -1, size 1000
ATTTTCATAGGATATTTACAAGGTATTCCCTATAAAGTATAAGAAAAGATACATGTCATA
AAAAAAATTACGAAAATGAGTACGAAAATAACTGAAATCCTGAAGTTATTTGATTTTCTT
GTCCTTTAGCTTTATTGTTTCATCGTTAACGTATATTCCTTTGCCTTTATACGGCTCTGG
TGGATGGAATTTTCTCAATTTGGCAGCAAAAAGAAGGACCTGCTGCTTATTGCACCCTTC
AATAATCAGAGACGTGGGAGCAGGTGTTTTGACAACAATACCTTCAGGAACGTCCAATCC
TTGTTTGATAGATGCACCCACCTTAACGTTGACAAATTTACCATCATTTTCTAATTGAGC
TCTATAACCTGTCCCTACAAATCTAAGGACAGCAAGATGCCCCTCAGTAACACCTATAAT
GTGATTATTTATAAGTGATCTTACTGTACCCCACATCGAACGTTGATGTTTATCTTCTGA
ATTCTGAACTGTAACATTTATTTTACCGTGCTTTTCATCCTTGTCCAAGTGCAAAAAATC
AGGGACCTCCACGGACAATTCACCCTTGGGTCCCTTTACTGTGATATTCTGTGATATATT
CATTGAAGTTCTACCTTTTCTGATAATCCTGGGCATGGATAATGCATTTATGGAAACCTG
AACTTCAGGAGATATATAAAGTGGTAAAGACCCCACTTGAGAGCGCAGAAAAAGTGTTTG
CGACAATAACCTCCTCTGAATAAATGACATAGGTTGGCCTCAATTCCTATAGTAAGATTT
GCGATAGCTTTATTGCGTGATCTTCCCTTACTTACTAGTATTTGATATTCTTCCTCTATA
ACCGTAGCGTCTCCTCGCTATTTCCGCTCGCCTTTCATTACCCTCTACTTCCAGTGAAAA
AAATTTCACTGATATAAGCTCATCGCAACAAAAATTCAATGGGATAAGTAATATAGAACG
TTCTAAATAGATAAACCACCAGGCATAATCACAACCAATA
Chromosomal Coordinates Chr VIII from 393534-394085
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator