Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ERG11
Systematic Name YHR007C
Alias CYP51
Description Lanosterol 14-alpha-demethylase; catalyzes the C-14 demethylation of lanosterol to form 4,4''-dimethyl cholesta-8,14,24-triene-3-beta-ol in the ergosterol biosynthesis pathway; member of the cytochrome P450 family; associated and coordinately regulated with the P450 reductase Ncp1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERG11	6321795 upstream sequence, from -1000 to -1, size 1000
CTTGTTCTCTCTCGCTTCCTACGTTACTCGCGCCTGTGCACTACATTCCCACCAGATTAA
CTCACCACCAGGCAGAGAACCAATTGTTCTTGTTATTGTTCCAACCGATAATTGTAAAGC
CATTAAGGTCGTAAACGACTGCTTACTCAGGGAGATCTCCGAAAACGGCAATTGCTGTGC
ACCGTGCGACGTTATGATCGCCGCCTGTCCCGTACAGACGAACAATTGCAACAATGGGCG
GTTGTTTAGAGAGGTTTTGTGCCGCGCCCGGGAATTACCGGGGGCACAGCAAAATACGAA
ATTTCCGGCAAAATGTCTCTGTACGAAAATGAGGCCAGCCTTTATTCCCGACTAAGCCGT
ACGATTATAGTAATGTCACACGAAGTGGATACTATACGAGCAGCGCACATACAATGTGCG
TGCAAGATTTGCCGGGTTGGACAATCTTAAAGGCCGATAATCCACGAAAAACGAGACAAA
CGAAGCGCTGGCCCTAAACGAAACGAAACGAAACTAAGATTTCAAGATAATCGCTTTTCA
GATGACAATAGTCTCTTGCAGAACACAATAAGTGTGGTAGGTATCTTGCAGGAGACATCG
ATTTTATGCCTGAATTTTTTTTTTTTCTTGGTATGAGCACATCCTATTGTGCATCTCCAC
GAGTTAACGACGTTTACGTACTCGCATGTATTCGAAAAGCCTCTAAAAATTGCCCTCCAT
GTGTATTCATTATATAAGATAGCGTATTTTCCCTTAGTTTTCTTATTCCCTCTTAATTCT
CTCTTTCAATGTCTTTTTTTTTTTCCCTTTTCCTTTTTCCCTTTTCGTTATTGGTAAATT
ATTTATAAAAAGATTGATAAGCAGTATCGTTCAGCGTGTGTATTTTCGATAGGAAGTAAT
AATTTTTCATTATATTAATTAATAGTTTCCAGAAAAAATTTTTTTTCCTTCACAATTGCA
GCAGGCTTGAATAGAAACAGAACAAACGAGTAATACAAGG
Chromosomal Coordinates Chr VIII from 121683-120091
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator