Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YRF1-3
Systematic Name YGR296W
Alias YRF1
Description Helicase encoded by the Y' element of subtelomeric regions, highly expressed in the mutants lacking the telomerase component TLC1; potentially phosphorylated by Cdc28p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YRF1-3	6321735 upstream sequence, from -1000 to -1, size 1000
CAGGGTATAGAACGCTGAGGCAAGCGCCGTGCATAATGATGTGAGTGCATCTAGTACTGA
TTTAGTGAGAATGGGCCATGGAGTGGAGTGTGAGAGTAGGGTAACTTGAGATGGTATATA
CTGTAGCATCCGTGTGCGTATGCCGTATCAGTATACAAGTGAGGGTGAGTGTGGCATGTG
GTGGTGGGATTAGAGTGGCAGGGTAAGTATGTGTGTATTATTTACGATCATTTGTTAACA
TTTCAATATGTTGGGTAGAACAACAGTATAGTGAGTAACAAGATGGGGCATGGTAGGGTA
ATGGCAGGGTAAGTGGTAGTGGAGTTGAATATGGGCAATTGGAGGGTAACAGGTGGTGGA
TGTGGGTGAGTGGTAGTAAGTAGAGAGATGGATGGTGGTTGGGGTGTGGTATAGTTGAAT
GAGACAGGGTAACTTGTGGGGAGGTAGGGTAATGGAGGGTAAGTTGAGAGACAGGTTAAA
TCATATATATGTCACTGTATTGCATGCTGGATGGTGTTAGACAAGGCCGTAGGGACATAT
AGCATCTAGGAAGTAACCTTGTACGAAAATAGGCAATATTTCCTGTTTAGGCGATTGTGA
CGCAGATTTTAGTCCAACGATCTAGCGTCAAGGAATTTTTTTATAGTGGGACATTGCACC
AAGGAAGTAACTTGATACGTCGTGGGTGAATGGGTCTGTTTTCTTATTCGGCGGGGTAAT
ACATTTTTGGGGGAAGTTTGTCTGTCTGACGCGCCATATGTAGGTACGCCAAAAAGGGCT
CCTCTACTTCGAAGCGCGAGGTCGTATACCTAATAAGGAAATGTAATTTATAACTTTCTA
TTATATTGGTCTTTTCGAGAGCGGAAGAAGTTGTAGGCTAAGCGCAGGCTAAGCGTAGGT
CCATATTTAAAGTATCCAAGAGAATATCCACGAAGCGGCTGAGCAACGAACAGAATCCTG
GTTCTCCTCGACTAAGCAGATAGTTAAGATACTGTGCACC
Chromosomal Coordinates Chr VII from 1084864-1084882,1085031-1090591
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator