Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BUB1
Systematic Name YGR188C
Description Protein kinase involved in the cell cycle checkpoint into anaphase; forms complex with Mad1p and Bub3p crucial to preventing cell cycle progression into anaphase in the presence of spindle damage; CDC28-mediated phosphorylation at Bub1p-T566 is important for its degradation in anaphase and adaptation of the checkpoint to prolonged mitotic arrest, but not to its kinase activity or chromosome segregation function; associates with centromere DNA via Skp1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BUB1	6321627 upstream sequence, from -1000 to -1, size 1000
TATGTTTCATTATTACATTATCAATCCTCGCATTTCAGCTTCCTCTAACTTCAATGACCG
CTTCTCATAACTTATGCCATCATCTAACACCGTATATGATAATATATTAGTAAAACGAAT
ACTACTAAATAAAAGATAATTTAGAGTTTCATTCCAACAATAGATGATAGTTGTAGTCCT
TATTCTAACAGTTTATAATTCTCGAAGAAAACTTCTATTACATTTATGCCACAGTTACCC
TTTCTAATAGGAAACTAAGTTCCATAAATTGTCATCAAGTTCTAACGCTGCCAAGATAGA
AAACCATCAAACGTTAAAATATAAAGTGCGGTTGGATAAAAACTAGAGACATCGACGCTG
TACGAAGAAAATATCGAAAGCTATCTCAAGGAACATAAAAATCCAATTCTGTAACAATTA
TATGCTGAATAGGTAAATTACAAAATAGAATTGTTAGATTTCGTTCTTAGCGAAGACAAT
AATGATATATAACATATATCAAAACATTCTCCTTTTGAGGTATTGAAAACATGCAAGTAG
AAAGGCAATTGAACGTTTTATGTAATGGTTTCTTATCTTGATTTTATACGTCACCTCTCA
TTAATCCTTTTATCCCCCCAATTCTCATGGTTCAGTTTCCATTGAATCTGATGACAGTTG
AGTTTTATTCTACCGACTCCATAACTTGTGCCAACTTTTAAAATAGTTCAAGGTAATGTC
TTAATGAATTCTCTACTAATTAATGCTCAATAGCTGGTTTTTATTTTAGGAGTGTGTTTA
ACGTTTGACTTCACGTCCATGGGGTCATCTTGTAACGGACACGGTTTTTTTGGTCTTTCA
TTGTTTTCGCTTTCGATACGCGCTAGGAAGTAAATAAAGAAAAAAAAGCGTTGTTCATAT
ACATACACAATATACGTGATTTTAGAATAGAGTATAAAGTTTTCATCATGGAAAGATTAT
TGACGGTTCCTATTGTTTGAATGTTAACGCTGACCAGGAA
Chromosomal Coordinates Chr VII from 875109-872044
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator