Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TIM13
Systematic Name YGR181W
Description Mitochondrial intermembrane space protein, forms a complex with Tim8p that delivers a subset of hydrophobic proteins to the TIM22 complex for insertion into the inner membrane
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIM13	6321620 upstream sequence, from -1000 to -1, size 1000
GAAATGCTCGTTCTAATGGAAAAAAAAAGAAATAAAGGTGGGCCTGCCCATTAGCAGGAA
ATTGGTACTTAATTATTGAAAAAAAAATTATTGGTTGCTAAGAGATTCGAACTCTTGCAT
CTTACGATACCTGAGTATTCCCACAGTTAACTGCGGTCAAGATATTTCTTGAATCAGGCG
CCTTAGACCGCTCGGCCAAACAACCACTTATTTGTTGAAAGCGAGCGCGGTACAAGTAAT
GTTACCTCATCTGATATACAATAAAGGTGGAGCGCCAATATATACGCATTTGACTGTTCA
TAATTCATTGAATATAATTTATTCCTTGTTAGTACAAAAGGGTTAAACAGAAAAAGACGT
GACGTTGTAACCGAGAGGATGGTAACACCGCGGTATCACCCACTCGCCCAGCCGTTAAAT
CCAATCATCCGAATAAAATGTTTGTCCTTGCTAGTTTGTCCTGGTGATAAAAGCCATGAC
CACTTTTCTTGGAGCCTGCATCTGTTATCTCTCCCGTCGATAATGGACTTTGCACCGGTG
TATTACCCGCAAGAATTCTGATAACGTTCAAGCTAAAACAAAACTGCTAAATGAGTTCTG
AAATGGCATTTATGAGTACATATGATAGATTTGCTATGTATCAAACCTGGAACTGGCGCT
AGCGCTATGGTTTCACTTCCTCATTAAACCATACCCTTGACGATTTGACAGGTCGCTACA
GATTCAGAAAGAGATCATATCAATACAACAAATAAAATATAAGCGAATAAAGAGCAATGT
CTTTCCCCTTTAGTCACATTACTAGCCAACGCTAATTCTTGATCTCCTTCCTCTTGTTTC
CGGTGTATCTTAGTTTTCCTGGCGTTGCCGAAGAGTAAAAAAATCCTAGGTCCTAAGATT
TATAAAATCGACAAAAAGAGGATTCAAGTAGGATATCTGTCAGTTCAAACCAATCAATCT
TTTCTCTCCAACAACAGTTTGAGCTTATTTAATCAAGAAA
Chromosomal Coordinates Chr VII from 858287-858604
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator