Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PRE9
Systematic Name YGR135W
Description Alpha 3 subunit of the 20S proteasome, the only nonessential 20S subunit; may be replaced by the alpha 4 subunit (Pre6p) under stress conditions to create a more active proteasomal isoform
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRE9	6321574 upstream sequence, from -1000 to -1, size 1000
CCGTTTTCCGGAGAAGCCAGTGATCAAGATAAAAAGGATGATATGATATATGAGATCTTG
AAGAAAAAGCAGAAGAATGAAGATGCTTCAGGACTTCCCTTTTCAAGGCAAGGACCTATC
GTATTATCTGATATTGAGACTAAAATGTTACTGCAGGAGTTTTTTATGAATGCTGCTATT
TTTTTGTCATCAAAAAATAACGAAGAAGAGAATGAAGACGGCGAGAAAATCTCCTTGTAC
TCCCTTGGTTTGGTTAGGTTGATCTGTTACATGGTGCAGACACTCATCGCGAACGACAAG
TTTTTTTTTACCAAATCAGAATGCACTTTTGAGCTTCAAACTTTACTGATGACATGGATT
GGCATCCTTCCTGAAGCCAAAGATTTATTCTTTAAGATCAAGACAAGGCTCGCCATGGAA
GAAGAGGATAGTGCCGATACTATGCAGCATGAGGGCAGGAAGAACTCTGACATAGAGAAG
AAGCTAAACGCTAAGCCAGCTTCTGAACTGAATCTGAAATTGTTAAACCTGTTTCCCTCA
AAGCCTGCAAACAAAGACGATAGTTCCCCTATTAACACGTTGCGTAGTTTTATCGCTGAT
TACTCCTTCGACACCCAGGTGAACCCTCCAGGAAGAAGGGTGGTGTTCTACGATGGTAAG
ATTTTGCCATTGCCCAAAGCCGATAAGCCTATCCCACTTCATGAATATATAACACTCGCA
GAGCTCGATGTTGGAGACAGTGAGTGAGCAGTGAATTGCTCATGTTTTCTCTGCATCCTC
ATTTAATGACAATTAGCCATGTAATAACATCTTGAGGCAGTTAAATATTCGTTACCCTGC
AGGTGGCAAAAAATTTATAGAATAAAAGCATAAAAAGATGGATATCTATGTAATAAGGAA
ACATTGGCAGAGCGAAGAGAACAGACTGCTTTCTATAAAAAGTTTTCGATCAGTCTCTAT
TTTAATAATTGATTATTGGATATAGTTAGTAGTGTTAAAC
Chromosomal Coordinates Chr VII from 761392-762168
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator