Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS23a
Systematic Name YGR118W
Description Ribosomal protein 28 (rp28) of the small (40S) ribosomal subunit, required for translational accuracy; nearly identical to Rps23Bp and similar to E. coli S12 and rat S23 ribosomal proteins; deletion of both RPS23A and RPS23B is lethal
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS23A	6321556 upstream sequence, from -1000 to -1, size 1000
AGCTTGACGATGCTCTTGACTTTTTCATTAATTTTAAATGACTTCGACGTCGCTTTCTCA
ATGTCGTAGATTACTAGGTATCCAGTAGCTGACGAAAGTAATATATATTTGCTATCTTCT
GTAAAAGTTGCGCTAATGAACAAGGTATCTTTGGGTAAGGATTTGTTCAATTTTACATCA
ATACTAAATTTCAAACTATGGTTCCAAGGTTGAATTCCATACTTAGCATTGTCAATTGGG
GCTAAATCATCGTTTATTGAAAGAGTTTTAAACCTATCTTTGAAAGACCGTCTTTTGTAG
TAAATCCTATCTTCAACGACACTCTGCAAGTCTTCTAGCGGTATCTCACCGACATTACTA
TTTGAACTATCGGACTTTTCTAAGGCAGAAAGAGGTAACGCTGTCTCCCTTATGAATGCA
GCTAATGTATCTTCCAGACCGTTATGTTTGAGATAATTAGCTATCAATAGATTAGTATAA
AATCTGGAAGTAGAATTGTCAGCCATGTCGGTCGCACTAGACTTTTCTTCTCACTGTCAC
TTACCTGTTTGAAATCATGTCCTTTTTTTTTTTGCCATTCTTATACATTTTCTTTCCTTC
TGAAATTAACTGTACACCCATACCCTATATACACCCATACCCTATTTTTAAATATAAAAA
GTAAACTTCATTTTGAAAGACCACTCTGCATCAGCACGCGGGCTCTGGAAGGAAGAAATG
ACGTTTCGGCGGAATACCCTTTCAGAAGGTCTGCTCTTGTGGCTGGTTCATGGGAGACAC
CCAGCGGAGCTCCTCCCGAGAAAGGCCCCTTCATCTCTGCCGATTGCTGACGGAAAGCAG
TAGCGGAGGTTTGAGTTCTCTACGCCGAGAGTACACTGCCGTAATATCACAATGTTTCGA
CTAACGGTTACAGTACGTTAAATTAGATACTGCCTATGAATTGACATATTAGATAATGTC
AAATTTTACAAAAACCTAAGACAACAGGAAATAAACAAAG
Chromosomal Coordinates Chr VII from 726974-727038,727358-727730
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator