Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name KSS1
Systematic Name YGR040W
Description Mitogen-activated protein kinase (MAPK) involved in signal transduction pathways that control filamentous growth and pheromone response; the KSS1 gene is nonfunctional in S288C strains and functional in W303 strains
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KSS1	6321477 upstream sequence, from -1000 to -1, size 1000
TTGGGATTCCATTTTTTATAAGGCGATAATATTAGGTATGTAGATATACTAGAAGTTCTC
CTCGAGGATTTAGGAATCCATAAAAGGGAATCTGCAATTCTACACAATTCTATAAATATT
ATTATCATCATTTTATATGTTAATATTCATTGATCCTATTACATTATCAATCCTTGCGTT
TCAGCTTCCACTAATTTAGATGACTATTTTTCATCATTTGCGTCATCTTCTAACACCGTA
TATGATAATATACTAGTAACGTAAATACTAGTTAGTAGATGATAGTTGATTTTTATTCCA
ACAGTATTTATGTTTTGTCATTCTTTTCTACATAATCTTGAAACTAGGTAGATCTACAAT
TGAAAAGTAAATACTAACATTATTTACTAAATTTAAGTTAGAAATCGGCACGAAAAAAAT
TTGACAGATTACGAGAGTCCAGCCAAAATATGAGTATATTACTATTTCCCCTTGGTGAAA
GAAATGAAAGATGTTATTTTTTACCGGCTTAGTAATACTGAGCTACTTACTTGGGGGAAA
GAAAGATTGGCTACTTATTATGTATGAAGCCTCAGATTACCTTGAATTCCTCAACCGTTT
GAGCAGTATGCTCTTCAAATTCGAACTTTTTGAACATCTTTCCTCCACATTCCTGATTTT
TTCACATTCAAAACGCGCTGTGAAGCTGTTAGAAATTTACAGATCGAGGCATATTTCTAT
ATATAATGTATTTTTATTAAGACACCCAAAGTACTTCCAATCTGTAGATATTGCACTTTA
TCTGACCAGAAGCCAGACTTGAACAGTTACATATTGTGCTTTGCAGTCGTTAAATTTCCC
GAACTGTTTTCGTATTTTTTTTTCTTTTCCTCTTTTCCACTGGATCAGATCAAAAGCCGA
CTAAAAATTTGGCAATTTAAAGAAAGCATCTTTTAAAGATAGAAAAGGTTATTTCAACAA
AAAAGTATCTTTTCTTCACTTTTCTTTCAACAATTCAAAG
Chromosomal Coordinates Chr VII from 575398-576504
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator