Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name UGA1
Systematic Name YGR019W
Description Gamma-aminobutyrate (GABA) transaminase (4-aminobutyrate aminotransferase) involved in the 4-aminobutyrate and glutamate degradation pathways; required for normal oxidative stress tolerance and nitrogen utilization
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UGA1	6321456 upstream sequence, from -1000 to -1, size 1000
TAGATACTCCAATTAACGACGACGACGACGACGATAAAAATAATGACGCCGACAATAATG
ACATTAACGAAGATAACAAACTTATAGAATCCATAGAGAACGATGAACACCATGAGGATG
AAGACGACTACTACCCTCAACCACAAGAATGGGAGGCTGAATTACTAAGACAATGGTCCT
CTCTATCAAGGCATACCAAGTCATTGTATAGGAAGCCAGCCCCGGGCCAGAAACTTACCT
CTGAAACTAGCAAACAACTGGACAAACTCCATAGAGGAGTTGACGGTGCTAAAGAGGACG
CTGGACTGGAAAACTTTGGTATTGTCTGTCTTTGTGTTGATTCTGTTGATTTTTTGAACT
TGAAAGAGGGAAGAGGTGGTGAAAGATGGATTTTCCAGAAAACCGACGGCAAAGACGAAG
ATCTGTGGGAGGAACAAGAAGTGTGTCCGTGAGAAATGTCAATCATTATTGCTAACGTTC
GCGATGGTTAATGCTTTGTATTCGCGCTATCTCGATTTCTACCTATATAGTTAATCTCTG
TACAAAAACAATCTTTCCAACTATCCATTAATCATAGTATATTATCAGCGTCGGCGATTT
TACCACGCTTGACAAAAGCCGCGGGCGGGATTCCTGTGGGTAGTGGCACCGGCAGTTAAT
CTAATCAAAGGCGCTTGAAGGAAGAGATAGATAATAGAACAAAGCAATCGCCGCTTTGGA
CGGCAAATATGTTTATCCATTGGTGCGGTGATTGGATATGATTTGTCTCCAGTAGTATAA
GCAAGCGCCAGATCTGTTTACTGTAAAATTAAGTGAGTAATCTCGCGGGATGTAATGATT
TAAGGGAATCTGGTTCAGGTTTTCACATATATTTGTATATAAGGCCATTTGTAATTTCAA
TAGTTTTAGGATTTTTCCTTCTCCCAAAATACTCACTTACTGTGTTACATTACAGAAAGA
ACAGACAAGAAACCGTCAATAAGAAATATAACTAAGAACA
Chromosomal Coordinates Chr VII from 525229-526644
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator