Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MCM6
Systematic Name YGL201C
Description Protein involved in DNA replication; component of the Mcm2-7 hexameric complex that binds chromatin as a part of the pre-replicative complex; forms a subcomplex with Mcm4p and Mcm7p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MCM6	6321237 upstream sequence, from -1000 to -1, size 1000
AACGCTGCATACTTGTCTTGGGTACTGCGTTAACCATAAATCACATAAGCGTCATTCATT
ATCGTACCTCTGGGTAAGTGTTTTTCAGGAGTTTTTATATATAATATGCTGGCCCCCAAG
GCGGATGAGGACTGTATACGGTTTTGACGTTAAAGTGTTATATGAATCGCAGTCGCATAC
ACTAGTGGACCCCTAGTTCCGCGATACGTAGTTGACCCTCAGTACAGAGATTCCCACGAT
TAACGGGTGTACTGCTCCTGACTAATGTAATTTTGAGTTCACCTGTTGATGTGGTGCTGA
TACTGGCACCAGTACTAATGTTTGGAAGAACTCCGTAGCATTAAGTGGAGAGATTAATCC
GATACTGAGCTGAATAGTTGGTTTCACTCCCGCAAAAAGATATCAATACAGTTTGCTAAC
AACTTGGGAAACCCTGATGAGAAGAATTAGCGGTCATCCTGAGAAATAGGTGACCATTTA
AATGGTCACTTGAATTCGATTTTCCAGTAAGGGAAGTGTCATTCGGAATCCAGAATATAC
CAGAAATAAGCAATTTTGCATGATAGTGCTGTTATCCTTTCTTGTGTTTTATACGATATC
ATACATCACCCCATTACGTTATTTATCTTGCATTTCAGTTTTTACTGGGTTTACCCTTTT
CGCGATTTATATCATATTATCACCGCACATAATATACTAGTAACATTACTATTCGTCGAC
AAACAATAGCTTGTTTTGATTCCAGTTCTCATAACATTTGTGTACCTATTCTTTTGCCGT
TCCTTCGCTATTTGGTATTGTCATCTAAGTTCGTCTATTAAATTTCCTTTTTAGGAAAAG
CGCCTAATAGGCCTTTCTTGAAGCTTTTTTTTTTTCTTTCTTTAATCTACAATAATAACA
AAATATTTCATTCTTAAGTGATTTACAGCGAGTATCTTACACTTCGCCACCGGTGGATAG
GAAAAATAGACTTACCAAAGGTTAAAACTGGTTTTTTTCA
Chromosomal Coordinates Chr VII from 120907-117854
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator