Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name Uncharacterized
Systematic Name YGL114W
Description Putative protein of unknown function; predicted member of the oligopeptide transporter (OPT) family of membrane transporters
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGL114W	6321324 upstream sequence, from -1000 to -1, size 1000
GAAGTGGTAGAATACCACTGATCGATCAAGATGAAGAGACACATAGAGAAATTGTCGTTA
GTGTTCTTACGCAATATAGAATTCTGAAGTTCGTTGCTTTAAATTGCAGGGAAACACATT
TTCTAAAGATTCCAATTGGGGACTTGAACATTATTACGCAAGATAACATGAAAAGCTGTC
AAATGACCACTCCGGTCATAGACGTCATTCAGATGCTTACCCAAGGTCGGGTTTCTTCCG
TCCCTATTATTGACGAAAACGGCTACTTAATCAACGTATATGAAGCATACGATGTCCTAG
GCTTGATAAAAGGAGGCATCTACAACGACCTGTCATTGAGCGTCGGAGAAGCCCTTATGA
GGAGAAGTGATGATTTTGAGGGTGTTTATACATGCACTAAGAATGATAAATTATCTACTA
TTATGGATAACATCAGAAAAGCAAGGGTGCATAGATTCTTTGTAGTTGATGACGTCGGAC
GGTTGGTTGGTGTCTTGACGTTAAGCGATATTCTCAAATATATCCTTCTAGGTAGCAACT
GAAACGAGCCGATGAGATTTTTGTGTACATACTATAAATAAATGCAACTAATAAAGTCAT
GATTAATCAGTCATGCATACTTCATCTGACCAATATATTTTCATCTTGCTTATTTTGGGT
ATAATTCGGCGGAAATTCGGTTATAAAGCGAAGTGAAAAATCGATTAGTAATGATACTGA
TGCGATCTCTGGGAGGGGGGAATGCTGCATATAAGGGTGAAGGAAGATAATGCAAAGCCT
TTTGTAGTATTGTCTGTTGATACCAAAATAAATTAGTTCATCAAAAAGGTACAGGCAGCT
AAAGAAAAGCTGTAAATTTAACGCCGTAGAAGGTATTTTTCGTGAGATCTATCTCAAGGC
ATCATTTTTTTTATTTTCGCACCAAGATAGGAAGAAAAAGAGTCACAGTATAGAGGACTA
ACCGTTAAAGATTCTAAATCGGTACTGTAAATACTTTGAA
Chromosomal Coordinates Chr VII from 293460-295637
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator