Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALG2
Systematic Name YGL065C
Description Mannosyltransferase that catalyzes two consecutive steps in the N-linked glycosylation pathway; alg2 mutants exhibit temperature-sensitive growth and abnormal accumulation of the lipid-linked oligosaccharide Man2GlcNAc2-PP-Dol
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ALG2	6321373 upstream sequence, from -1000 to -1, size 1000
ACCTTATTTTCTGTTCCGCTACTATTCCTCAAGAGTTTAATAAAACAATGCAAAGACTAT
TTCCTACAGTGGTTCCTATAATGACACCCAGACTGCATAAGTTACCATTCGCTTTGGACT
TTAAAGTTATAAATTCTGCCTTAAGTCCTTTCAAGGGATCCAAGATCAAAGCATTGGCAC
AAACTTTATATGCTATTTCAAATGATGACACGGAACCAGGGTTCGAGAAAAGATGCATTA
TCTTTGTTAACGAAAAAAAGAATGTTCCTGAAATTGTTAACCTATTGAATAAGAAATTCG
GTCATAATGCCATCGGTTTAACTGGTGAAGATACATTTGAAGAAAGATCCGAGAAAATTA
TGCCCTTTTTATCACCACCGCGACCACTTTCGGAGGTGGTTGCTCAGAGTACTTCACCTC
CCACTTCCTTGAAGAAATTTGAAATTCCTGATTCCAACATCGTCATCGGCAAATTGAAAA
ACACAAATTCTAATGGTACCGCACCCAGTAACAAGTCTTTGCATGTACTCGTAACCACCG
ACCTCATGGCAAGAGGGCTCAATTTCAAAGGTGTACGGAATGTTGTTCTCTACGATGTAC
CCAAAACGTCAATAGACCTGATACACCGAGTGGGCAGAACTGCTAGAATGAAACAGGGCG
GCCGCGTATTTATGCTAACTGACAGTAAAACAAAATCTTGGGCTAAAGCTCTTCCAAAGA
TCATCAAAAAGCACCAGAGATTATCATGATAAATGTATATTCTTGTAAATATTATAACAT
ATATACGAAAGGGTCACAATCACAGATACAATTTATAGATCGAGAGCCTTGCGTATAGCT
TCTTTTTTTATAAACAAGTGCCTGGCTAGATGAACGCGCGAACAACAAAATAAATGATGT
ATTCATTTTAACATCAAAAGATTACGTTCGCCATTTAAGAAGTCACGAAATAGATACAGT
AGTAAAGACAGATAAAAAAGAGTCGATTAGACAAGCAAAA
Chromosomal Coordinates Chr VII from 381271-379760
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator