Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PMC1
Systematic Name YGL006W
Description Vacuolar Ca2+ ATPase involved in depleting cytosol of Ca2+ ions; prevents growth inhibition by activation of calcineurin in the presence of elevated concentrations of calcium; similar to mammalian PMCA1a
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PMC1	6321432 upstream sequence, from -1000 to -1, size 1000
TTAAACTAATCAAGCATGAATAATACAAAATAAATATTTGAGCCAAAGGGGATGATTTAA
TTATCAAGTTTTTCTTTTCATACTTCGGTTTACAAGCATTGTTTACGGCTCTTCTTTTCT
TAGTTCTTGGCAGTTTGTGTTTTCTTGATGAGAATAAGAAAAGTATCGATCTTACGGCAA
AACATAAATAAAACACAACTTTATCTTTTTTTGTCGCAGTAGTGTGGTCCTACAGCTCCA
AGCCTGCCGCTTTTAAAATAGTGAGCTGTGCATACTGATATATGTTCTATTTTACCCATT
TGAGGGGCCTAAATTGTCTATTAATTTTTTTACTTTAATACAGTTTGTATAGAAACATGT
GGCACTAACAGCTTTATCCGCCCGCAGAAAAGATAAAAAAAAAGGGTTTTTACCCGGCAA
AGAAGCTTCTCCATCATTTGTCAGGGGGAAAAGAAAATTAGGAGGCTCAGGCCCTAGAAG
CGCCCTCCACGCTTTTTAAACAAATGCTAATCTTCATAATTCATTATCATCGCCACTTGG
CATTGCATTTAATGGGCGCCTTCCAAAAACATTCAAATAGTATCAGCCCCCCCCCAAGGA
AAGGCTTTATTTGAATTGCGTTAAATATTCGATTTCTTTCTAGCAATTATTACCAAAATA
AATTGCAGGCTTAACGAAAAATTAAATAATCTCTTCAGATTTTTTCACTTCCCCAAACTA
CATTTTAGTCAGGTTGGCACGATTCAATTGAGAAGGCTTAGGTTAAGAATAAACATTTTT
TCATAAATTTGAGGAAGAAGGGGCTTTTCTGGTAATTTTCATTCAATAGAAAGGCTTAAG
AAAACGTCAAAAAACTCATGCGCCTCCAGTAAAAACTAAGTGTATTAAGAGAATTGTATC
ACATATATACGACATTGAATTAAAGAAATAAAACTTGAACAAATAAAGTTTAGAAAAGTG
GTTCTAAAAAAAAAAAACTGTGTGCGTAACAAAAAAAATA
Chromosomal Coordinates Chr VII from 485921-489442
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator