Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RSC8
Systematic Name YFR037C
Alias SWH3
Description Component of the RSC chromatin remodeling complex; essential for viability and mitotic growth; homolog of SWI/SNF subunit Swi3p, but unlike Swi3p, does not activate transcription of reporters
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RSC8	14318562 upstream sequence, from -1000 to -1, size 1000
TGTGTCCATTTCATATATGAACGCCAAAAGAGCAATACTTTGAACAGTCTTACCAAGACC
CATTTCATCGGCAAGAATTCCGTTCAGGCCATTTTCATAAAGAGTGATCAGCCAGTTAAG
ACCTTCTAGTTGGTAAGGTTTTAAAATACAGTTTTTCAATAGGCGAGGTTGCTTTATTGC
TGCATCGTCTGGTGCGCCGTTTTGGGTGGTTGTATCTTCGTTCTTTTTCTGTTTTTTGAA
GAAATCTGTTATTGATTTTTTTTTTGTTTTACGTTTTTTTGAAGAATGTTCTTCATCATC
AGAGTTGCTGTTATCTTTTGTATTAGCGTTAGCCACTTCATTAGATCGATGTAGTAAAGT
ATCGGCGATTATACTGGAATATACCTGACTCTGCCTCACAAACTCGTTTAGTTTCTTAAG
TTTTAAAGAAACCGTCTTGGTATCCATCTCGGAGAGCTCATCATCCAAGGATTTTTGCTC
TGATTTCGTGTCTTTTGCCAATTTATCCACCACTTGGGCTTGAACAGCTTCTGTATCGGA
ATCGTCCTCTGAGTCCAGCTGAATATCTTCGTCTGAATGCACATCATCTTGTAACCATAT
GGGGGCAGTGTCATTGTCGCCTTTGCCATGTTTATTGTCCTCTGAATCCAAATCTGAATC
TGAATCTGAAATGTCAGCCGTTAGGTCATTGACTTCCTTCTCCCGGTAATTGACGCCATT
GCTCATGTTTCTCGTCCTTGCAGCCACCCTGGCCCCAACAGCATCCTCAACAACAGTCAT
CAGCGCCGCGTTTGAGCATCTGCTCATCTCATCGCCAAATTTGATACTTCCTTAATCCGT
TACTCTTTTCTATGATAATTTAATTACGGCGTTCTCTTTGTCACCCGCTTGATGTAAAAA
AGTTGGAAAAAATAAGTTTCATCAACATTGAATTAGTTCGTGAGGTTTATAGAGAGAAGG
GTAGAGCAGAGAAGCAAAGAGTAGATAGAAGGCCAGGATA
Chromosomal Coordinates Chr VI from 229186-227513
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator