Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CCA1
Systematic Name YER168C
Alias TNT1
Description ATP (CTP):tRNA-specific tRNA nucleotidyltransferase; different forms targeted to the nucleus, cytosol, and mitochondrion are generated via the use of multiple transcriptional and translational start sites
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCA1	6321016 upstream sequence, from -1000 to -1, size 1000
ACTGTATAATGTTATAGGTCTTGTTTTTCTCCACGTTCTGCACCATAAAAAGACCTTTAT
TACCAGAAATATGCTGCTGAATAGGTGATTTAATCTTGATCTTTTGGAGCGTTTCCGCAG
AATAAGGCAGATCTAATTTGTCTTTCCATTCTTTAGGTGGGATTACTTTCACAACACCAC
TTTTCATGCCATATTTGTTTATGGCCTTGCAGTATGCATAGAAATCTTCGAATTGCTCGT
ATGTGGGTTTGAAGACGGGCACTCCGCCCACGATTTCTGAAGGAGCGATTAGTTTCGTCA
TGATTTCACGCAACTGAATATCCTCACCAAGACAGTCTTATTCTTTTTTTCCCTTTTTTT
TATCTGTTTATTTTTCTCCAGCAGATCTATAAAATAAGTGGTACTAATAGAAAGGTTAAG
TCCCCCTATTTTAAAATAATGCTGATAGAATGATTAAATTGGCCGCTTGATGAAAACCGC
AAGTAGCTACTTCAGGGACAAGCAACGCCTTCGATGCGAATATATGTTTTGCTGATAACG
ATCTATGTACAGCGTCTGCAATTCTCTTAAAATTATCGCCTTGCCATTGTTACTTAAGGA
GTCTATGTGATTAATTGCATGGCGATGAGGTTACCCTTGAAAAATATAGAAAAGATTTTT
CCGAATAAAAAGAAAGTAAAACTAAAAAAAAAAAAAAAATGGAAAAAGAAAAAGAAACGT
TTAGGGGAGAGGAGGGCTGCGGTTAAGGCTTATGGGGTGTATGGGCGGGGGAAATAGGGC
ATACTTTCTCGATTCACCAAACCCTTAGGTCATCTGATTTTTAGGGTTGTGTTCTTGTCG
TTACTCAGCCCTAAAAAACATTCGTTAGGGTTGAAAAGTTGAAAAATGAATCGCAAAAAT
CTACCATATTAACAATGTACTAAAGGAAACTACATAATACATCGCAACGCTTCCCTCGAG
ATTAATTCGTATCCGTGGGTTATAAGGGCTTTTTTTGTGT
Chromosomal Coordinates Chr V from 522669-521029
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator