Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name UBP3
Systematic Name YER151C
Alias BLM3
Description Ubiquitin-specific protease that interacts with Bre5p to co-regulate anterograde and retrograde transport between the ER and Golgi; inhibitor of gene silencing; cleaves ubiquitin fusions but not polyubiquitin; also has mRNA binding activity
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UBP3	6320999 upstream sequence, from -1000 to -1, size 1000
TACTGCATCCCGACGTTTGCAAACCCATCGGGAAACACATACTCGCTTGAGACCAGACGC
AGACTTATCGACATCGCTCGGAAGTACGACATGCTGATAATCACTGATGACGTGTACGAT
ATTCTAGATTACACGACGCCCTCAGATGAGCTGCCCTCTCCGCCCCTAAGGATGGTGCAC
ATAGACAGAAGTACAGCGCCCTCCGGTGAGGACTCGTTCGGGAATACAGTGTCCAACGCA
ACTTTCTCCAAGCTGATCGCCCCTGGGCTCAGATTTGGATACCATGAGTCAATCAACGCG
AATCTCGCCAGACAGCTATCTAAAGGTGGTGCAAACGTCTCTGGCGGAACTCCCTCACAA
CTGAACTCCATGATCGTGGGTGAGATGCTGCGTAGTGGTGCCGCCCAGAGATGCATTGCA
CATCTGAGATCCGTATACTCCGAGAGGGCCACTGTCTTGACCTCGGCGCTTAAGAAATAC
ATGCCCCTAGGAACCGAGATTATGCCATTGAAGGGCGGCTATTTTACTTGGATCACTCTC
CCACCAGCGTACAATGCCATGGAGATATCCACTATTCTTGCCAAGAAATTTAATGTCATC
CTTGCCGACGGCTCCAATTTCGAGGTCATCGGCGATGAGAAAAACTGGGGTCAGTCATGC
TTTAGGCTTTCTATTAGTTTCTTAGAAGTTGATGATATCGACAGGGGCATTGAGCTGTTT
GGTGCTGTTTGCAAATCTCATGCGATCACCAATAACATAACTATGTAGAAGGAATACGTA
TATAGGTGAACGGTAATAAGAGGGTAATTTTTCTACGGGCAAAGGCAAGGAAGAAAAAGA
AAAAGAAGGAAAAAAATATAATGTGATAAAACAAACAAGCAGCGAAAAAGCGAAAGGGAA
GAGAAGTGTTTCTAGAGAAGAAAGTCATTTTAATAGTAAGTCAGACTCGTCTGCTACCAT
CATCCAGGTACCGCTTTCCTTTCCATCATCATTAAAAAAA
Chromosomal Coordinates Chr V from 472424-469686
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator