Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FTR1
Systematic Name YER145C
Description High affinity iron permease involved in the transport of iron across the plasma membrane; forms complex with Fet3p; expression is regulated by iron
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FTR1	6320993 upstream sequence, from -1000 to -1, size 1000
AAGCCACTCGACAGCGTCTTCCAGTATAACGTTGACGAAGTCGTCGAAACCAACTAACGT
GCCCTCGAACTCGCGGTTCGACTGCAGCACAATCAACACTTTCTGGTTAATTGTTTTATC
TATGACTTCCAAAGGCAAAATCTCCGGTAGACTCATTTTGCGCGCTTCTGTGTATGCTTG
TGAGTGCACGTGTATACGCTATGCTTGTTGTGAGACCATCTATCCGCCAAGGAAGCCTTT
TTCGCTTTCTCTGTATTTTTTCTACTTCAATAAGAAAGCAAGTATTCTGTTTTGCTACCC
GGATGCAAAGACAAAACCCGAGCATCCGGGTAATAAAAGAGCAGGGTCCGGCTGAAGGTG
CCAAAAAAGACCAAAAAGGGCTATATTATCTCTCTCTTACGATTGCCTCTGGTTAAAAAA
TGAAATAGATAATAAAAGGGCAGCAAAGAAAAAAAAGAAGAATACAATATACGTATACGT
TCTCAACAATTTTTCGTCCTGTTTTTTTCTTGACCACGGTCACTACTAACTCCTGAGACA
TCAGACCAACGTGTAGAAAAAAAGAAATCGGGTCCGGCACTGACACACGCTCTGCGCCAA
TCAACCAGGGCGCATCGAGCATTCTTTCCAGGCCAGGGTGCAGAAATACTATTATTAAGT
GCGCGAATACTGCTGGTGCATTAAACGAGCGAGTACAGTGAGCCCGCCGCTGACTGCCGA
CTCACGCCAGGCCGCTATTTCCTTCCCCCGCCCGCGTAAGCCGTGCCGAGCACCGTCGCA
GCAGTAAGAAGGTGCGCATTTCATTCTCTGCACAGCGTAGATGAATGCACCCGATTTCTA
AGTTGGTGTTGCAAGGCCCGGTGGAAGCGATGGGCTGTAGTTCGACCTTGAGCTTTTAGT
TATATAAAATGCTCAATGTGAGCAAAAAAATACATAACACGACGGATTGTACGTTGTCGA
AATCTTCTCTCAGCAGGTCATCACACATATACTTCCCGCC
Chromosomal Coordinates Chr V from 461740-460526
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator