Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FLO8
Systematic Name YER109C
Alias PHD5, STA10, YER108C
Description Transcription factor required for flocculation, diploid filamentous growth, and haploid invasive growth; genome reference strain S288C and most laboratory strains have a mutation in this gene
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLO8	6320955 upstream sequence, from -1000 to -1, size 1000
TTGCCAATCTTGTATGTATGTGTCCTGAGGGACCTATTGTATGCAATACTTTTTTATTGT
ATTAAGGTTATGTGAGTTTCGTCCTGTAAAGTTGATCGGCGCATCTACACGCCGCCGATC
AACTCAGCGATGATTCTCTTGGCATCGTCCATCTCGAAGGAAAGAACTTAAAGAAAGCTC
AAAAGGATGTTGACGACGCAATTCGAACAGAAGGCAGCTTTCGGCGAATATCCCAGAACG
GAAATAACCGGGCCTTGCGTATTTTCCATATGAATACGCGCAAGTTCAGGTCATCTTGTA
CTTGTTCTAATGAAAGAATCACGGCACGTTACTAATTAGCGGGCCCCGGATATTGGTCTT
GTACAAATGTAAATTATTTGACGATGTATAGTACATGTAATTTACTGAAATATATGCAAG
TTACCTGCAGGTTTTACCTTCTCCTGCACATTCTTGTGATAAGAATGTGAAAAATTTTTT
GCTGTATTTCCAGTTCTAATGCTGGCTCTAGTAGTAACAAAAATAGAAAATGCCTCGAAT
AAGTAGCCCTGGGAGTGGGATACTGAGGAATTAAACGTTTATGCAGGCGTGTGCTTGCGT
CCACATGCATGCATATCAATAGTGGACGCAACAGGGACCACAGTTCAACTGGCCAGGGTC
CATTGTTGTGTTTGCCAACGAGTGTATAGTGCATGAAATCGCGCCTTCTCGGCTTCGGAC
TCTTTTACGAGGGTCCGGAAGAGCGTGGGAAGACAACGAAGAAAGAATGGGATCACGATG
AAGTTGTAGAGGGTTGGTTTGAGACCGGTACTGATAAAATTCATAGAATACAGATTGAAA
AAGTGACCATTTTTTACTCCTGTTCAAGCGCATTTGCTTTGATACCATTTTGTTTGCCGA
AGACACGGTGAGTTGACGTTAGTAAGTCACTGAGGCTATAAAAAATAAACACGAAGACGT
TTATAGACATAAATAAAGAGGAAACGCATTCCGTGGTAGA
Chromosomal Coordinates Chr V from 377614-375215
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator