Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SSA4
Systematic Name YER103W
Alias YG107
Description Heat shock protein that is highly induced upon stress; plays a role in SRP-dependent cotranslational protein-membrane targeting and translocation; member of the HSP70 family; cytoplasmic protein that concentrates in nuclei upon starvation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SSA4	6320950 upstream sequence, from -1000 to -1, size 1000
AGATTATACGCTTGTATCTCTTCCAGACCAGGTCAATCCGGTAGATGTGATGGTTACATC
TTGGAAGGTGAAGAATTAGCTTTCTACCTAAGAAGATTGACTGCTAAGAAATAGAGATAA
TAAGATAATATTTTATTACACTACATGTACAATTTTACTTTTACTTTGTGTTGTCTCTAT
CTGCTTTCTTATTTTTAATATTTACCATTCCATTTATAATTTGTAAAACAATTAACATAA
AAGTTTTTTAAACTCTAGACCAGCAACATATCTTCAAATATCAGTTGATAAGGTAAAGTA
TGTTGATAGCATTCTACCGTCACACTTATCTAGCAGATCTTTGTTAGGTAGATCTGCTAA
TATATTTTACGTAAGATTCGTTGTATGTGCGGGAAAATTTGTATCTGTTGTGGTAGTCAC
TCACCCTTTCTATGTATTAAAAACTGATACCTTCCATACTAGAAAAGACATTCAGTTGAA
TCCTTCTCCAAATCAAGGATACTATTGTCACTTCTCCATTGAGATTCGAAAAACCCCTCG
GGTCTTGTTAGAACTAAATTACGTTCATAGGGGTGGGATTTATATTGTAATTCCGCGAGG
TTTACACGAAAGATATCTCAACTCTAGCCGCACATCCATTCCGGTATGTACTCTCCCACC
ATTGGGTATTATAGAATGTAATAGGTTTCAAAGCGGATATCTTTTGCCCGGTGAGTTGTT
ACTTTTTCATTCGAGCAATGAAGTACATTCTAGAAGTTCCTAGAACCTTATGGAAGCACC
AAGAAAAAAGGAAGTTAAACAAAACACTGATTCAATAAGCAAGGGGGGAAGCTCCTTAGT
TTGACGACAGTAACAAAATGTTCGTATAAATTGAACGAAACTCAAGCCAATAAAGGACTT
TTCAGAGGCCTATCTCTTCTTTCTCCACAACTTTCGAATAAAAACCACTAATAAAAAGTA
AATAACAAAAACAAGAAAAAAAATAAACAAAACAATAATC
Chromosomal Coordinates Chr V from 364589-366517
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator